ID: 1114584266

View in Genome Browser
Species Human (GRCh38)
Location 14:23795449-23795471
Sequence CTCCATCTTGAATAGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114584266_1114584273 30 Left 1114584266 14:23795449-23795471 CCCGGCTCCTATTCAAGATGGAG No data
Right 1114584273 14:23795502-23795524 TGTTGATATATTATTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114584266 Original CRISPR CTCCATCTTGAATAGGAGCC GGG (reversed) Intergenic
No off target data available for this crispr