ID: 1114584931

View in Genome Browser
Species Human (GRCh38)
Location 14:23802631-23802653
Sequence TCTGGAGCCCAGGAAGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114584927_1114584931 24 Left 1114584927 14:23802584-23802606 CCTGAGAGTGGGTAATTCATAAA No data
Right 1114584931 14:23802631-23802653 TCTGGAGCCCAGGAAGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114584931 Original CRISPR TCTGGAGCCCAGGAAGATCA AGG Intergenic
No off target data available for this crispr