ID: 1114586331

View in Genome Browser
Species Human (GRCh38)
Location 14:23817321-23817343
Sequence CCAGTGATGTGGCCGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114586323_1114586331 20 Left 1114586323 14:23817278-23817300 CCCTCAGAGGTGAGGGGAAATGC No data
Right 1114586331 14:23817321-23817343 CCAGTGATGTGGCCGGTGTCTGG No data
1114586324_1114586331 19 Left 1114586324 14:23817279-23817301 CCTCAGAGGTGAGGGGAAATGCT No data
Right 1114586331 14:23817321-23817343 CCAGTGATGTGGCCGGTGTCTGG No data
1114586326_1114586331 -6 Left 1114586326 14:23817304-23817326 CCACCACAATGTTGTCTCCAGTG No data
Right 1114586331 14:23817321-23817343 CCAGTGATGTGGCCGGTGTCTGG No data
1114586327_1114586331 -9 Left 1114586327 14:23817307-23817329 CCACAATGTTGTCTCCAGTGATG No data
Right 1114586331 14:23817321-23817343 CCAGTGATGTGGCCGGTGTCTGG No data
1114586322_1114586331 25 Left 1114586322 14:23817273-23817295 CCTGACCCTCAGAGGTGAGGGGA No data
Right 1114586331 14:23817321-23817343 CCAGTGATGTGGCCGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114586331 Original CRISPR CCAGTGATGTGGCCGGTGTC TGG Intergenic
No off target data available for this crispr