ID: 1114586935

View in Genome Browser
Species Human (GRCh38)
Location 14:23824216-23824238
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114586935_1114586950 30 Left 1114586935 14:23824216-23824238 CCCTCCCACTTCCTCTTACACTG No data
Right 1114586950 14:23824269-23824291 TGCCAGTCATTTCCCAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114586935 Original CRISPR CAGTGTAAGAGGAAGTGGGA GGG (reversed) Intergenic
No off target data available for this crispr