ID: 1114587440

View in Genome Browser
Species Human (GRCh38)
Location 14:23827202-23827224
Sequence GGCTGAGGACTGGGAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114587440_1114587447 -4 Left 1114587440 14:23827202-23827224 CCAGCCACTCCCAGTCCTCAGCC No data
Right 1114587447 14:23827221-23827243 AGCCTTCCCCGTGTGGCACAGGG No data
1114587440_1114587451 3 Left 1114587440 14:23827202-23827224 CCAGCCACTCCCAGTCCTCAGCC No data
Right 1114587451 14:23827228-23827250 CCCGTGTGGCACAGGGTGTCTGG No data
1114587440_1114587446 -5 Left 1114587440 14:23827202-23827224 CCAGCCACTCCCAGTCCTCAGCC No data
Right 1114587446 14:23827220-23827242 CAGCCTTCCCCGTGTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114587440 Original CRISPR GGCTGAGGACTGGGAGTGGC TGG (reversed) Intergenic
No off target data available for this crispr