ID: 1114587446

View in Genome Browser
Species Human (GRCh38)
Location 14:23827220-23827242
Sequence CAGCCTTCCCCGTGTGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114587436_1114587446 20 Left 1114587436 14:23827177-23827199 CCTTCTATGCCTCTCACCATGAC No data
Right 1114587446 14:23827220-23827242 CAGCCTTCCCCGTGTGGCACAGG No data
1114587435_1114587446 23 Left 1114587435 14:23827174-23827196 CCTCCTTCTATGCCTCTCACCAT No data
Right 1114587446 14:23827220-23827242 CAGCCTTCCCCGTGTGGCACAGG No data
1114587437_1114587446 11 Left 1114587437 14:23827186-23827208 CCTCTCACCATGACCACCAGCCA No data
Right 1114587446 14:23827220-23827242 CAGCCTTCCCCGTGTGGCACAGG No data
1114587438_1114587446 4 Left 1114587438 14:23827193-23827215 CCATGACCACCAGCCACTCCCAG No data
Right 1114587446 14:23827220-23827242 CAGCCTTCCCCGTGTGGCACAGG No data
1114587439_1114587446 -2 Left 1114587439 14:23827199-23827221 CCACCAGCCACTCCCAGTCCTCA No data
Right 1114587446 14:23827220-23827242 CAGCCTTCCCCGTGTGGCACAGG No data
1114587441_1114587446 -9 Left 1114587441 14:23827206-23827228 CCACTCCCAGTCCTCAGCCTTCC No data
Right 1114587446 14:23827220-23827242 CAGCCTTCCCCGTGTGGCACAGG No data
1114587440_1114587446 -5 Left 1114587440 14:23827202-23827224 CCAGCCACTCCCAGTCCTCAGCC No data
Right 1114587446 14:23827220-23827242 CAGCCTTCCCCGTGTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114587446 Original CRISPR CAGCCTTCCCCGTGTGGCAC AGG Intergenic
No off target data available for this crispr