ID: 1114587451

View in Genome Browser
Species Human (GRCh38)
Location 14:23827228-23827250
Sequence CCCGTGTGGCACAGGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114587441_1114587451 -1 Left 1114587441 14:23827206-23827228 CCACTCCCAGTCCTCAGCCTTCC No data
Right 1114587451 14:23827228-23827250 CCCGTGTGGCACAGGGTGTCTGG No data
1114587443_1114587451 -7 Left 1114587443 14:23827212-23827234 CCAGTCCTCAGCCTTCCCCGTGT No data
Right 1114587451 14:23827228-23827250 CCCGTGTGGCACAGGGTGTCTGG No data
1114587436_1114587451 28 Left 1114587436 14:23827177-23827199 CCTTCTATGCCTCTCACCATGAC No data
Right 1114587451 14:23827228-23827250 CCCGTGTGGCACAGGGTGTCTGG No data
1114587442_1114587451 -6 Left 1114587442 14:23827211-23827233 CCCAGTCCTCAGCCTTCCCCGTG No data
Right 1114587451 14:23827228-23827250 CCCGTGTGGCACAGGGTGTCTGG No data
1114587439_1114587451 6 Left 1114587439 14:23827199-23827221 CCACCAGCCACTCCCAGTCCTCA No data
Right 1114587451 14:23827228-23827250 CCCGTGTGGCACAGGGTGTCTGG No data
1114587440_1114587451 3 Left 1114587440 14:23827202-23827224 CCAGCCACTCCCAGTCCTCAGCC No data
Right 1114587451 14:23827228-23827250 CCCGTGTGGCACAGGGTGTCTGG No data
1114587438_1114587451 12 Left 1114587438 14:23827193-23827215 CCATGACCACCAGCCACTCCCAG No data
Right 1114587451 14:23827228-23827250 CCCGTGTGGCACAGGGTGTCTGG No data
1114587437_1114587451 19 Left 1114587437 14:23827186-23827208 CCTCTCACCATGACCACCAGCCA No data
Right 1114587451 14:23827228-23827250 CCCGTGTGGCACAGGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114587451 Original CRISPR CCCGTGTGGCACAGGGTGTC TGG Intergenic
No off target data available for this crispr