ID: 1114588694

View in Genome Browser
Species Human (GRCh38)
Location 14:23839358-23839380
Sequence CTGTATCCAGAGCTAGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114588691_1114588694 -5 Left 1114588691 14:23839340-23839362 CCCAGAATGAGCCAAATACTGTA No data
Right 1114588694 14:23839358-23839380 CTGTATCCAGAGCTAGAGTCAGG No data
1114588692_1114588694 -6 Left 1114588692 14:23839341-23839363 CCAGAATGAGCCAAATACTGTAT No data
Right 1114588694 14:23839358-23839380 CTGTATCCAGAGCTAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114588694 Original CRISPR CTGTATCCAGAGCTAGAGTC AGG Intergenic
No off target data available for this crispr