ID: 1114591503

View in Genome Browser
Species Human (GRCh38)
Location 14:23869191-23869213
Sequence AGTTTTTAAGAGATGGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114591497_1114591503 17 Left 1114591497 14:23869151-23869173 CCAGAACTCAGTCTGAACACAAT No data
Right 1114591503 14:23869191-23869213 AGTTTTTAAGAGATGGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114591503 Original CRISPR AGTTTTTAAGAGATGGGGTA GGG Intergenic
No off target data available for this crispr