ID: 1114592517

View in Genome Browser
Species Human (GRCh38)
Location 14:23880087-23880109
Sequence GATCCAGCAAATCCCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114592515_1114592517 8 Left 1114592515 14:23880056-23880078 CCTCAAAAAACTAAAAATTAAGC No data
Right 1114592517 14:23880087-23880109 GATCCAGCAAATCCCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114592517 Original CRISPR GATCCAGCAAATCCCACTGA TGG Intergenic