ID: 1114594038

View in Genome Browser
Species Human (GRCh38)
Location 14:23895875-23895897
Sequence AAGGATGCATATTCTACATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114594038_1114594041 7 Left 1114594038 14:23895875-23895897 CCCAATGTAGAATATGCATCCTT No data
Right 1114594041 14:23895905-23895927 CAAAGCTACCACACAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114594038 Original CRISPR AAGGATGCATATTCTACATT GGG (reversed) Intergenic
No off target data available for this crispr