ID: 1114595797

View in Genome Browser
Species Human (GRCh38)
Location 14:23910677-23910699
Sequence CAGAGAAATCACACAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114595791_1114595797 22 Left 1114595791 14:23910632-23910654 CCAGGCAGGTAGGGAACGCTGTG No data
Right 1114595797 14:23910677-23910699 CAGAGAAATCACACAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114595797 Original CRISPR CAGAGAAATCACACAGTTGC TGG Intergenic
No off target data available for this crispr