ID: 1114597583

View in Genome Browser
Species Human (GRCh38)
Location 14:23926596-23926618
Sequence TGCAGCTAACCCAACCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114597581_1114597583 17 Left 1114597581 14:23926556-23926578 CCATGCTACTCGTTGTTTAAGAG No data
Right 1114597583 14:23926596-23926618 TGCAGCTAACCCAACCCCACTGG No data
1114597580_1114597583 27 Left 1114597580 14:23926546-23926568 CCTGTTCTTTCCATGCTACTCGT No data
Right 1114597583 14:23926596-23926618 TGCAGCTAACCCAACCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114597583 Original CRISPR TGCAGCTAACCCAACCCCAC TGG Intergenic
No off target data available for this crispr