ID: 1114599008

View in Genome Browser
Species Human (GRCh38)
Location 14:23939134-23939156
Sequence CAGCTTTTCTAGAGGGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114599001_1114599008 13 Left 1114599001 14:23939098-23939120 CCTTTCAGGAAGGTTCTCTGCCA No data
Right 1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG No data
1114598998_1114599008 29 Left 1114598998 14:23939082-23939104 CCATTACACAGGACTGCCTTTCA No data
Right 1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG No data
1114599005_1114599008 -7 Left 1114599005 14:23939118-23939140 CCACTGGAAAAGGGTACAGCTTT No data
Right 1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114599008 Original CRISPR CAGCTTTTCTAGAGGGCAAT AGG Intergenic
No off target data available for this crispr