ID: 1114603889

View in Genome Browser
Species Human (GRCh38)
Location 14:23980094-23980116
Sequence GTGCAATAAAAAATGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6463
Summary {0: 2, 1: 2, 2: 82, 3: 2763, 4: 3614}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114603885_1114603889 11 Left 1114603885 14:23980060-23980082 CCAATAAAGAAGAAAAGAGAGAA 0: 88
1: 62
2: 53
3: 509
4: 9592
Right 1114603889 14:23980094-23980116 GTGCAATAAAAAATGATGGAGGG 0: 2
1: 2
2: 82
3: 2763
4: 3614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114603889 Original CRISPR GTGCAATAAAAAATGATGGA GGG Intronic
Too many off-targets to display for this crispr