ID: 1114604854

View in Genome Browser
Species Human (GRCh38)
Location 14:23988456-23988478
Sequence GTGGACTCCATGGGGACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 2, 1: 1, 2: 0, 3: 16, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114604848_1114604854 -10 Left 1114604848 14:23988443-23988465 CCAGCCTCACCTGGTGGACTCCA 0: 3
1: 0
2: 2
3: 21
4: 222
Right 1114604854 14:23988456-23988478 GTGGACTCCATGGGGACCACAGG 0: 2
1: 1
2: 0
3: 16
4: 141
1114604843_1114604854 17 Left 1114604843 14:23988416-23988438 CCTATCACGTCTCTCTCCCAGGC 0: 3
1: 0
2: 1
3: 14
4: 218
Right 1114604854 14:23988456-23988478 GTGGACTCCATGGGGACCACAGG 0: 2
1: 1
2: 0
3: 16
4: 141
1114604844_1114604854 1 Left 1114604844 14:23988432-23988454 CCCAGGCTGCTCCAGCCTCACCT 0: 2
1: 0
2: 11
3: 69
4: 579
Right 1114604854 14:23988456-23988478 GTGGACTCCATGGGGACCACAGG 0: 2
1: 1
2: 0
3: 16
4: 141
1114604845_1114604854 0 Left 1114604845 14:23988433-23988455 CCAGGCTGCTCCAGCCTCACCTG 0: 2
1: 0
2: 9
3: 105
4: 727
Right 1114604854 14:23988456-23988478 GTGGACTCCATGGGGACCACAGG 0: 2
1: 1
2: 0
3: 16
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114604854 Original CRISPR GTGGACTCCATGGGGACCAC AGG Intronic
900181695 1:1313913-1313935 ATGCGCTCCCTGGGGACCACCGG + Exonic
900487417 1:2929954-2929976 GTGGCCTCCATGGGGAGCCAAGG - Intergenic
900923731 1:5690304-5690326 GTGGACCCCATTGGGCCCAGGGG + Intergenic
901468572 1:9439802-9439824 GTAGGGTCCATGGGGCCCACTGG + Intergenic
901491277 1:9597584-9597606 TTGGACTCCATGGAGGGCACAGG - Intronic
901952182 1:12758060-12758082 GTGGTTTCCATGGGAACCATTGG - Intronic
902326314 1:15703118-15703140 TTGGTCTCCATGGAGCCCACAGG + Intronic
903726643 1:25452270-25452292 GTGGACTACATGGGCACGAGGGG - Intronic
908316292 1:62936128-62936150 GTAGAATCCATGGAGGCCACTGG + Intergenic
912687639 1:111779667-111779689 CTGGACTCCCTGAGAACCACAGG + Intronic
917377451 1:174364783-174364805 GTGTACTCCATGGGTATCAGTGG + Intronic
918372981 1:183880521-183880543 GTGGACCCCAGGGGCACCCCTGG - Intronic
919287220 1:195579229-195579251 GTGGTCTCCATTGATACCACTGG - Intergenic
919762365 1:201106176-201106198 GTGGAATCCATGGTGAGGACTGG - Intronic
919827658 1:201515010-201515032 GTGGACTCCAAGGGGCAGACAGG + Intergenic
920788612 1:209066766-209066788 GTGGATTCCTTTGGGAACACTGG + Intergenic
921407802 1:214799912-214799934 GTGCACTCCATGTGGGCCACTGG - Intergenic
922920195 1:229295415-229295437 GTGGAATCCATAGTCACCACAGG - Intronic
1066205582 10:33186262-33186284 TTGGACACCAAGGTGACCACTGG - Exonic
1067086172 10:43239740-43239762 GGGGTCTCCATGGGAACTACTGG - Intronic
1067279111 10:44857953-44857975 GTGCACTGCAGGGGGACCGCAGG + Intergenic
1067476702 10:46572223-46572245 GTGGCCTCCATAGGGAGCTCGGG - Intergenic
1067618035 10:47769557-47769579 GTGGCCTCCATAGGGAGCTCGGG + Intergenic
1068857030 10:61808310-61808332 GCTGACTCCATGGGGAGGACTGG + Intergenic
1069554002 10:69384832-69384854 TTGGACTACATGGGGATCAAAGG + Exonic
1071290450 10:84185188-84185210 AGGGATTCCTTGGGGACCACTGG - Exonic
1075918249 10:126188293-126188315 CTAGACTCCATGTGTACCACTGG + Intronic
1076352963 10:129831384-129831406 GTGGACCCCATGTGGACCCCAGG + Intergenic
1077295383 11:1823986-1824008 GTGGACCCCATGTGCCCCACTGG + Intergenic
1077500081 11:2905392-2905414 GTGGGGTCAATGGGGACCTCAGG + Intronic
1077500754 11:2908908-2908930 GTGGAATCCCAGGGGACCAAAGG - Intronic
1081787558 11:45757924-45757946 CTGGACTCCATGGTGTCCAGAGG - Intergenic
1084403843 11:68959962-68959984 ATGGGATCCATCGGGACCACAGG - Intergenic
1087370686 11:97279897-97279919 GTGTACTCCCTGGGTATCACTGG - Intergenic
1087981760 11:104622805-104622827 CTGAAGTCCATGGGGACCACGGG - Intergenic
1089568805 11:119388590-119388612 GTAGAATCCATGGCGCCCACTGG - Intergenic
1090351292 11:126110155-126110177 GTGGTCTCCGTGGGGAGGACTGG + Intergenic
1090404702 11:126469650-126469672 TTGGTCTCCATGAGAACCACTGG + Intronic
1102152106 12:110695892-110695914 CTGGAGTCCATGTGGAGCACAGG + Intronic
1104946479 12:132417002-132417024 GGGGGCTCCATGCGGACCCCTGG - Intergenic
1112247286 13:97746679-97746701 GTGAACTCCATGGGCAACAGAGG + Intergenic
1114600617 14:23953312-23953334 GTGGACTCCATGGCGACCACAGG + Intergenic
1114604854 14:23988456-23988478 GTGGACTCCATGGGGACCACAGG + Intronic
1114610300 14:24036003-24036025 GTGGACTCCATGGGGACCACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1117339718 14:54782932-54782954 GTGGCCTGCAGGGGGACCCCGGG + Intronic
1119172408 14:72545182-72545204 TTGGACTCCTTTGGGACCACTGG + Intronic
1121445718 14:93977670-93977692 GGGGACTGCCTGGGGACCACTGG - Intergenic
1121613928 14:95300140-95300162 GGCCACTCCATGGGCACCACTGG + Intronic
1122125519 14:99576562-99576584 GTGGACTCCCTGGGCCTCACAGG - Intronic
1123215722 14:106807583-106807605 CTGGACTTCATGGGCAGCACAGG - Intergenic
1123907928 15:24938713-24938735 GGGGACTCCAAGGGAAACACAGG + Intronic
1123920708 15:25067927-25067949 GTGGAACCCATGGGAACCAGTGG - Intergenic
1127431511 15:58914517-58914539 GTGGAGTCCTTGGGGAGCAGGGG + Intronic
1127702490 15:61514697-61514719 GGGGACCCCATGGGGAGCTCTGG + Intergenic
1130046638 15:80450915-80450937 GTGGCCGCCATGGGGGCAACGGG - Exonic
1131098943 15:89673215-89673237 GTGGACAGCCTGCGGACCACCGG + Exonic
1131558520 15:93419756-93419778 GAGGACCCCATGAGGCCCACTGG - Intergenic
1131915265 15:97258175-97258197 CTGGACACCATGAGGACTACTGG - Intergenic
1132586214 16:706662-706684 GAGGACTCGGTGGGGACCGCTGG + Intronic
1133679896 16:8111045-8111067 CTGGACTGCATGCGGCCCACAGG + Intergenic
1134370269 16:13617075-13617097 GTGAACACCATCAGGACCACTGG - Intergenic
1137056166 16:35747606-35747628 GTTGACTGCCTGGGGACAACCGG + Intergenic
1142848600 17:2693797-2693819 GTGGAGTCCAGGGAGACCCCAGG - Intronic
1144716254 17:17437769-17437791 GTGGACTCCGTGGGGGCTCCGGG + Intergenic
1147767840 17:42849004-42849026 GTGGACATCATGGGGAAGACAGG + Intronic
1150292758 17:63990949-63990971 GGCAACTCCGTGGGGACCACAGG - Intergenic
1152121912 17:78424039-78424061 TTGGTCTCCATGCGGTCCACAGG + Exonic
1152464137 17:80456336-80456358 CTGCACTCCCTGGGGACCTCTGG + Intergenic
1152886138 17:82851499-82851521 GTGGACTGCATGTGGCCCACAGG + Intronic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157305480 18:46514015-46514037 CTGGGCTCCTTAGGGACCACTGG + Intronic
1159019902 18:63134892-63134914 TTTGTCTCCATGGGGACCTCTGG + Intronic
1160578031 18:79868019-79868041 CTGGACCTCATGGGGACGACGGG - Intronic
1161234104 19:3189604-3189626 GTGGACGCCATGGAGGGCACCGG - Intronic
1163720956 19:18898122-18898144 GTGGACTCCATGTGGACTAGGGG + Intergenic
1164299782 19:23951671-23951693 GTTGTCTGCATGGGGACCACTGG + Intergenic
1164854581 19:31511188-31511210 GGGGAGTCCATAGGGACCACTGG + Intergenic
1166949421 19:46416599-46416621 GCGGTCTCCATGGCAACCACGGG + Intergenic
1168713240 19:58513427-58513449 GTGGCATCCATGCGGCCCACAGG - Intergenic
925170614 2:1748115-1748137 GTGGATGGCCTGGGGACCACTGG - Intergenic
926401886 2:12505539-12505561 GAGGACTCCAAGTAGACCACTGG - Intergenic
929030276 2:37643916-37643938 TTGGACTTCATGCGGGCCACAGG - Exonic
929966591 2:46541939-46541961 GTGGCCTCCAGGGGGAGCCCAGG + Intronic
931763583 2:65436131-65436153 GAGGACTCCACGGGGCCCAAAGG + Intergenic
932054885 2:68433499-68433521 GTGCACTCCATGGAGCACACAGG - Intergenic
935199530 2:100844240-100844262 GGGGACTCCATGGGGTCAAGGGG + Intronic
938812532 2:134866971-134866993 GTGGAATCCCTGGGGTCTACAGG - Intronic
940052951 2:149483121-149483143 GTGGACCCCAGGGGACCCACTGG + Intergenic
941730795 2:168914921-168914943 GTGGACTCCAGGGATACCTCTGG + Intergenic
945508502 2:210671360-210671382 GTGGATTCTACGGGGACCTCTGG - Intronic
948278734 2:236730147-236730169 GTGGACTCTGTGGGGAAAACAGG - Intergenic
948973296 2:241445980-241446002 GTGGACTTCATGGGTCCAACAGG - Intronic
1171010898 20:21508950-21508972 ATTGACTCCATGGGGACCCGAGG + Intergenic
1171232694 20:23500296-23500318 GTGGGCTGCCTGCGGACCACAGG + Intergenic
1171487265 20:25494029-25494051 GTACACTCCAGGGGGCCCACAGG + Intronic
1173469173 20:43309379-43309401 TTGGATTCCAGGTGGACCACTGG - Intergenic
1175421999 20:58840545-58840567 GTGGAGTGCTTGGGCACCACCGG - Intronic
1176369997 21:6056831-6056853 GTGGTCTCCACGGGGACCAGGGG - Intergenic
1177056954 21:16318137-16318159 GTGGACTGCATGAGGACGCCCGG + Intergenic
1179528608 21:42001955-42001977 GAGGAATCCAAGGGAACCACAGG + Intronic
1179546825 21:42118268-42118290 GTGGTCTCCCTGGGGTCCACAGG + Intronic
1179753522 21:43481710-43481732 GTGGTCTCCACGGGGACCAGGGG + Intergenic
1179987185 21:44928343-44928365 ATGGACTCCAGGGGGAAAACCGG + Intronic
1180219309 21:46347928-46347950 GTGGCCTCACTGGGGACCACAGG + Intronic
1181330471 22:22086940-22086962 TTGGCCTCCCTGGGCACCACTGG + Intergenic
1182300272 22:29333251-29333273 TAGGACTCCCTGGGGACCCCTGG - Intronic
1185102680 22:48850132-48850154 GTGGACTCCACAGGCACCTCTGG + Intronic
953414966 3:42710460-42710482 ATGGCCTGGATGGGGACCACTGG - Intronic
954035652 3:47849616-47849638 GTGGCCTCCCTAGGGAACACAGG - Exonic
955410656 3:58653485-58653507 GTGGAGTCCATGGGGAACAGAGG - Intronic
959598333 3:108152004-108152026 GTGGTCTCCTTGGGGACCCTTGG + Intergenic
970016333 4:11516689-11516711 CTGGGCTCCATGTGGCCCACGGG + Intergenic
972001560 4:34042183-34042205 GTAGGCTCCTTGGGGACCTCTGG - Intergenic
983849975 4:172568823-172568845 CTGGACTGCATGTGGCCCACAGG - Intronic
984054380 4:174908788-174908810 GTGGGGTCCATGGGTACCAGTGG + Intronic
985971393 5:3381223-3381245 TTGGAGGCCATGGGGTCCACTGG + Intergenic
986034487 5:3924910-3924932 GTGGACTCTATGTGGACAATGGG - Intergenic
986814785 5:11396981-11397003 GTGGACTCCAAGGGGACAGGTGG - Intronic
992228923 5:74644207-74644229 GCTGACGCCATGGGGACCTCTGG + Intronic
993840846 5:92876616-92876638 GTGGCTGCCATGGGGACCTCTGG + Intergenic
1000265130 5:159629012-159629034 GTGGAGTCCTGGGGGACCTCAGG + Intergenic
1001938835 5:175727014-175727036 CTTGACCCCGTGGGGACCACTGG - Intergenic
1003950175 6:11109322-11109344 CTGGACTCCAGTGGGTCCACTGG + Intronic
1003974690 6:11331160-11331182 GTGATCTCCATGGGGAACAGTGG + Intronic
1005954769 6:30656219-30656241 TTGGACAGCATGGGGTCCACCGG + Exonic
1006285655 6:33092150-33092172 GTGACCTCCAGGGGGAGCACTGG - Intergenic
1006763591 6:36485405-36485427 GAGCCTTCCATGGGGACCACAGG - Intronic
1012254802 6:97019391-97019413 GTGGACTCCACAGGGAACACAGG + Intronic
1015100718 6:129476490-129476512 CTGGACTCAATGGTAACCACGGG - Intronic
1015514866 6:134073666-134073688 CTGGTCTCCATTGGAACCACTGG - Intergenic
1017059020 6:150463563-150463585 GTGTACACCTTGAGGACCACAGG - Intergenic
1020570318 7:9851752-9851774 GTGGTCTCCACTGGCACCACGGG + Intergenic
1021517452 7:21503903-21503925 ATGGAGTCAATGGGGACCCCAGG - Intronic
1023721150 7:43096111-43096133 CTGGGCTGCATGGGGCCCACAGG + Intergenic
1026213516 7:68327813-68327835 ATGGTCCCCATGGGGGCCACAGG - Intergenic
1029090091 7:98041054-98041076 GCGGACTCCATAGGGAGCGCCGG - Intergenic
1032079236 7:128850405-128850427 ATGGACTCCATTGGCTCCACAGG - Exonic
1038408965 8:27343457-27343479 GGGGACTACATGGGGTCCCCAGG - Intronic
1038842764 8:31201406-31201428 GTGGACTGCCTAGGGACCTCAGG + Intergenic
1039216028 8:35272458-35272480 GTGGATTCCACGGGGAGCTCTGG + Intronic
1039743510 8:40403268-40403290 GGGTGCTCCATGGGGACCATAGG + Intergenic
1041314212 8:56544676-56544698 GTGGTTTCCATGGGGAACACAGG - Intergenic
1043294909 8:78650244-78650266 GTTATCTGCATGGGGACCACTGG - Intergenic
1048162907 8:132037470-132037492 GTGGGCTCCACAGGAACCACTGG + Exonic
1048292215 8:133189891-133189913 GCGGTCCCCATGGGGAGCACAGG + Intergenic
1048491858 8:134901624-134901646 ATGATCTCCCTGGGGACCACAGG - Intergenic
1049038296 8:140093905-140093927 GTGGACTCCATGGGGAGTTTTGG - Intronic
1049243406 8:141549930-141549952 GAGGACTCCTTGGGGACAGCTGG - Intergenic
1049575734 8:143388844-143388866 GAGGACTGCCTGGGGACCCCTGG + Intergenic
1051714262 9:19964967-19964989 TTGAACTCCATGGGGAAGACAGG - Intergenic
1053131877 9:35619992-35620014 GGTGACTCCCTGGGGACCTCAGG + Intronic
1061145723 9:128797226-128797248 GGGGAGTCCCTGGGGACCCCAGG - Intronic
1061296929 9:129681884-129681906 CTGGGCTCCCTGGGGATCACGGG + Intronic
1062517418 9:136943596-136943618 GTGGGTTCCAGGGGCACCACGGG - Intronic
1187250433 X:17593367-17593389 GTGGATTCCAGTGGGCCCACTGG + Intronic
1190141136 X:47846176-47846198 GTGGACTCAACGGGGACTGCTGG - Exonic
1198683098 X:139203207-139203229 GCGCACTCCAGGGGGACCAGTGG + Intronic
1199342472 X:146697712-146697734 CTGGGCTCCATGTGGCCCACAGG + Intergenic
1201958545 Y:19651880-19651902 GTGGACTCAAGGGGGTCCCCTGG + Intergenic