ID: 1114605242

View in Genome Browser
Species Human (GRCh38)
Location 14:23990678-23990700
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 2, 1: 1, 2: 0, 3: 26, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114605242_1114605246 -10 Left 1114605242 14:23990678-23990700 CCCCTCTTCTTCAGCTTATAGAG 0: 2
1: 1
2: 0
3: 26
4: 242
Right 1114605246 14:23990691-23990713 GCTTATAGAGTCAAGTCCCTGGG 0: 2
1: 1
2: 0
3: 12
4: 82
1114605242_1114605247 -1 Left 1114605242 14:23990678-23990700 CCCCTCTTCTTCAGCTTATAGAG 0: 2
1: 1
2: 0
3: 26
4: 242
Right 1114605247 14:23990700-23990722 GTCAAGTCCCTGGGAACCTCAGG 0: 2
1: 1
2: 1
3: 10
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114605242 Original CRISPR CTCTATAAGCTGAAGAAGAG GGG (reversed) Intronic
900718266 1:4158882-4158904 TTCTACAGCCTGAAGAAGAGGGG - Intergenic
900907335 1:5568777-5568799 CTGTAAAAGCTGCAGAAGTGGGG + Intergenic
903099383 1:21014969-21014991 CTCAATAAGCTAAAGAAAGGTGG + Intronic
904292308 1:29495926-29495948 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
906953007 1:50349615-50349637 CTGAATGAGCTGGAGAAGAGTGG - Intergenic
907475945 1:54705591-54705613 ATTTATGAGGTGAAGAAGAGTGG + Intronic
908313296 1:62907242-62907264 CTCCATAAGCACAAGGAGAGGGG + Intergenic
908821491 1:68091923-68091945 CTCTATAAGCCAAAAGAGAGTGG - Intergenic
909476559 1:76087363-76087385 CTCTATTTGCTGAAGATAAGTGG - Intronic
909679590 1:78277098-78277120 CTCTAGAAGCTGGAGAAGCGAGG + Intergenic
909984655 1:82145833-82145855 CTCTAAAAGCTTTATAAGAGTGG + Intergenic
910803591 1:91168224-91168246 TTGGAGAAGCTGAAGAAGAGAGG + Intergenic
911124581 1:94329171-94329193 CTCTATAAACTGTAGTATAGTGG - Intergenic
912076540 1:105883020-105883042 CTCTAAAAGCCGGAGGAGAGTGG - Intergenic
912297947 1:108488274-108488296 CTCTACAAGCTGAAAGAGAGTGG + Intergenic
916152129 1:161804468-161804490 TTCAGTAAACTGAAGAAGAGAGG + Intronic
918977496 1:191509129-191509151 CTATATAAGCTGAAAAATAAAGG + Intergenic
919038002 1:192341082-192341104 CTCTAGAAGCTGAAAAAGGCAGG - Intronic
919456534 1:197827083-197827105 CTCTAGAAGCTGGACAAGAAAGG - Intergenic
920246465 1:204591357-204591379 CTCTTTACAATGAAGAAGAGTGG - Intergenic
921280236 1:213559289-213559311 CTCTATAAGCTTCAGAACAAAGG - Intergenic
921770176 1:219027393-219027415 CTCTATAAGCTGAAAGCCAGTGG + Intergenic
923416570 1:233768485-233768507 CTCTACAAGCTAGAAAAGAGTGG - Intergenic
924386807 1:243506745-243506767 GTCTATTTGCAGAAGAAGAGAGG - Intronic
924540242 1:244973791-244973813 CTCTAAATATTGAAGAAGAGTGG - Intronic
924890936 1:248279427-248279449 TTATATAACCTGAAGCAGAGTGG - Intergenic
1063851287 10:10194646-10194668 CTCCATAAGCTGAACAAGTCAGG + Intergenic
1067962960 10:50877343-50877365 CTCAATAAGGTTAAAAAGAGAGG - Intronic
1069041738 10:63703011-63703033 CTATATATGCTAAAGGAGAGAGG + Intergenic
1069328754 10:67264685-67264707 ATCTATAATGAGAAGAAGAGAGG - Intronic
1069389901 10:67923664-67923686 CTCCAGAAGCTGAGGTAGAGAGG - Intronic
1069725034 10:70571978-70572000 TTCTAGAAGCTCCAGAAGAGAGG - Intergenic
1071224166 10:83508714-83508736 CTCTCTAAAAAGAAGAAGAGTGG + Intergenic
1071436645 10:85653742-85653764 TTTTATAAGGAGAAGAAGAGAGG + Intronic
1071934059 10:90507093-90507115 TTCTATAAGCCAAGGAAGAGAGG + Intergenic
1072533563 10:96342174-96342196 CTCTATAGGATGGAGGAGAGAGG + Intergenic
1073773734 10:106763472-106763494 CTCAGTAAGCTGAATAAGAGAGG - Intronic
1078415318 11:11160156-11160178 CTCTAGAAGCTGAAAAAGGCAGG - Intergenic
1079342385 11:19623094-19623116 CTCTATAAGCTAGAAGAGAGTGG - Intronic
1080176879 11:29374274-29374296 CTGTGTAAGCTGAAGAACAGTGG - Intergenic
1081068484 11:38578078-38578100 CTCTAAAACCTGCAGAACAGTGG - Intergenic
1083106602 11:60364353-60364375 CTCTCTGAGCTGGAGATGAGGGG - Intronic
1084727820 11:70953375-70953397 ATCTATAAGCTGGGGAAGAGAGG + Intronic
1087162817 11:94966384-94966406 AACAAAAAGCTGAAGAAGAGAGG - Exonic
1088080588 11:105907070-105907092 CTCTATAAGAGAAAGAATAGTGG + Intronic
1088745001 11:112797778-112797800 TTCTACAAACTCAAGAAGAGGGG + Intergenic
1089481737 11:118811268-118811290 CTCTAGAAGGTGATGAGGAGAGG + Intergenic
1090696525 11:129249227-129249249 GTCTATAAGGTGAAGAGGATTGG + Intronic
1090898373 11:131001703-131001725 CTTTAGAAGCTGGAGAAGTGAGG + Intergenic
1091889116 12:4039048-4039070 TTCTATAAACTGTAGAAGAATGG + Intergenic
1092482121 12:8869121-8869143 CTGGAGAAGCTGAATAAGAGAGG - Exonic
1092645548 12:10567687-10567709 ATTTATTAGCTGAAGATGAGTGG - Intergenic
1094074639 12:26459284-26459306 TTCTAAAACCTGGAGAAGAGGGG - Intronic
1095279443 12:40333285-40333307 TTCTGCAAGCTGAAGAAGAAAGG - Intronic
1097235501 12:57536693-57536715 CCCTAGAAACTGAAGCAGAGAGG + Intronic
1098554606 12:71804279-71804301 CTCCATGAGCAGAAGAACAGAGG + Intergenic
1098878248 12:75889553-75889575 TTCAATCAGCTGAGGAAGAGAGG + Intergenic
1099280063 12:80632630-80632652 CTCTTTAACTTGAAGGAGAGAGG + Intronic
1100202184 12:92311151-92311173 CTCTAGAAGCTGTTGAAAAGTGG + Intergenic
1101684793 12:107008381-107008403 CTCAATAAGCTCCAGGAGAGGGG - Intronic
1102172018 12:110849453-110849475 TTCTAAAAGCAGAAGGAGAGAGG + Intronic
1104926086 12:132314621-132314643 CTCTCTAAGGTGCAGGAGAGGGG - Intronic
1105567889 13:21569392-21569414 CTCTATAAGCAGAGCATGAGAGG - Intronic
1105570254 13:21595849-21595871 GCCTATAGGCTGAAGGAGAGTGG - Intronic
1107753484 13:43594494-43594516 TTGTTTAAGCTGAGGAAGAGGGG + Intronic
1107911474 13:45109247-45109269 CTCAGTAATCTGAAGAGGAGAGG - Intergenic
1108106225 13:47013689-47013711 CTGTATCAGCTGAAGGAGATGGG + Intergenic
1108270910 13:48758693-48758715 CAATATGACCTGAAGAAGAGGGG - Intergenic
1110087492 13:71399807-71399829 CTCTATAAGCTGACTAATAGAGG + Intergenic
1110156380 13:72321823-72321845 CTCTAGAAGCTGCAAAAGACAGG + Intergenic
1111954756 13:94744042-94744064 CTCTAGAAGCTGAAGAGGTCGGG + Intergenic
1113285230 13:108839176-108839198 CTTTATAAGAAGAGGAAGAGAGG - Intronic
1113417814 13:110143893-110143915 TTCAACAAGCTGAAGAAGAAAGG + Intergenic
1114601031 14:23955531-23955553 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114605242 14:23990678-23990700 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114610715 14:24038310-24038332 CTCTGTAAGCTGAAGAAGAGGGG - Intergenic
1115716962 14:36116544-36116566 CTTAATAAGCTCAAGAATAGTGG + Intergenic
1117796862 14:59404039-59404061 CTCTATAAGCCAGAAAAGAGTGG - Intergenic
1118814183 14:69298327-69298349 ATCTACAAGCTGAAGGAGGGAGG - Intronic
1119104662 14:71912761-71912783 CTCTATAAGCTGACCCAAAGTGG - Intergenic
1120552799 14:85891865-85891887 CTTTATAAGAAGAGGAAGAGGGG - Intergenic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1121510980 14:94513382-94513404 CTCAAGAATCTGAAGCAGAGCGG + Intronic
1121842682 14:97147591-97147613 CTCTAGAAGCTGAAAAAGGAAGG - Intergenic
1125425777 15:39548162-39548184 CTCTATCAGCTGAACATAAGTGG - Intergenic
1126437556 15:48651342-48651364 AACTAGAAGCTGAAGCAGAGAGG - Intergenic
1129555910 15:76509258-76509280 GTGTGAAAGCTGAAGAAGAGGGG - Intronic
1129793878 15:78361399-78361421 CTCTGTAACCTGAAGAGGAAGGG - Intergenic
1131590228 15:93740677-93740699 CTCTATCAGCTGGAGAACACTGG + Intergenic
1134656600 16:15952294-15952316 CTCCACCAGCTGAAGAAAAGGGG - Intronic
1138058944 16:53868274-53868296 CTATAAAAGCAGAAAAAGAGTGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141747537 16:85935829-85935851 CTCTAAAGGCTGGAGAAGCGAGG + Intergenic
1147011534 17:37452971-37452993 CTGGATAATCTGAAGAAGGGAGG - Intronic
1149177049 17:53885167-53885189 ATCTATGAGCTGAAGAATGGAGG + Intergenic
1150204503 17:63392069-63392091 TTCTATCAGAAGAAGAAGAGAGG - Intronic
1150582230 17:66484572-66484594 CTCCATTAGCTGAAGAACATTGG - Intronic
1153201656 18:2654202-2654224 CTCAATTTGCTGAAGTAGAGAGG + Intergenic
1153349518 18:4063396-4063418 CTATATAAGATACAGAAGAGAGG + Intronic
1153411616 18:4799727-4799749 CTCCACAAGCAGAAGAACAGAGG - Intergenic
1153560030 18:6362429-6362451 CTCTGTTAGCAGAAGGAGAGAGG - Intronic
1155561248 18:27079781-27079803 CTCTAGAAGCTGCAGAAGGCCGG - Intronic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1158689121 18:59644417-59644439 CTTTGTAAGCTGAAGAAGACAGG - Intronic
1158790340 18:60773111-60773133 CTCTATAAATTAAACAAGAGTGG - Intergenic
1159064426 18:63554121-63554143 GACTATAAGCTGAATAAGGGGGG + Intergenic
1159811039 18:73018201-73018223 CTCTATAAGCCAAAAGAGAGTGG + Intergenic
1167298014 19:48663225-48663247 CTCTGTAAGCCGAAGAACATGGG + Intronic
925641030 2:5985957-5985979 CAGGATGAGCTGAAGAAGAGGGG - Intergenic
925934170 2:8737314-8737336 CTTAATAAGAGGAAGAAGAGAGG + Intronic
930222311 2:48756988-48757010 ATCTATAAGCAGTTGAAGAGAGG - Intronic
930295846 2:49552685-49552707 TTCTGTTAGCTGTAGAAGAGGGG - Intergenic
933525303 2:83430656-83430678 GTCTATAAGCTGAAATAGATGGG + Intergenic
933825159 2:86153151-86153173 CTATATAAGCTGAGGAGGAGTGG + Intronic
934698726 2:96421274-96421296 CTCTATAAGCTAGAAGAGAGTGG - Intergenic
937861235 2:126712176-126712198 CATTATTAGCTGAAGAAGAATGG - Intergenic
938123136 2:128647680-128647702 CTCCAGAAGCAGAATAAGAGAGG - Intergenic
939064275 2:137463907-137463929 CTCTATAAGCTGACTAAAACTGG + Intronic
939750392 2:146037796-146037818 CTGTATTAGCTGAACAATAGGGG - Intergenic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
941702132 2:168614787-168614809 CTCTAGTAGCTGAAGACAAGAGG + Intronic
942897736 2:181077823-181077845 TTCAATAAGCTCAACAAGAGTGG + Intergenic
943539086 2:189189234-189189256 CTCTATCAGGAGAAGAAGAGAGG - Intergenic
944562782 2:200957691-200957713 CTATATAAACTGTGGAAGAGTGG - Intronic
945175339 2:207038139-207038161 CTCTATAAGCCAAAGAAGTCTGG + Intergenic
1170095963 20:12646375-12646397 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1170391072 20:15875063-15875085 CTCTAGAAGCTGGAAAAGCGAGG + Intronic
1170715488 20:18827633-18827655 CTTTATAAGCAGAGGAAGAGAGG + Intronic
1172310830 20:33917211-33917233 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1173392877 20:42650478-42650500 CTCAATCAGCTGCAGTAGAGGGG + Intronic
1174296265 20:49547449-49547471 CTCTGTAAAATGAAGGAGAGAGG - Intronic
1175018614 20:55819543-55819565 CCTGATAATCTGAAGAAGAGTGG - Intergenic
1175175174 20:57107253-57107275 CTCTAGAAGCTGGAAAAGACAGG - Intergenic
1178218510 21:30628148-30628170 CTTTATAAGCTGAGAAAAAGGGG - Intergenic
1178435625 21:32555639-32555661 CTCTATGAGATGAATAATAGTGG - Intergenic
1178826046 21:36017810-36017832 CTCTGAAAGGGGAAGAAGAGAGG - Intergenic
1181291536 22:21798190-21798212 CTATATCAGCTGAGGTAGAGAGG + Intronic
1181750107 22:24983318-24983340 CACTGGAAGCTGAAGAAGAAAGG - Intronic
1183182529 22:36270254-36270276 CTATATAAGCTGGAAGAGAGTGG - Intergenic
1184463633 22:44656000-44656022 CTCTAAAAGCTGAAAAAGACAGG + Intergenic
949940404 3:9150199-9150221 ATCTAAAGGCTGAAGAGGAGTGG + Intronic
951064289 3:18246413-18246435 CTGTGTAAGCAGAACAAGAGAGG - Intronic
952894288 3:38066805-38066827 CTCTATATGCTGAACATTAGAGG + Intronic
954918570 3:54169806-54169828 CTATATAAGGTGGAGAAGAAAGG + Intronic
955553393 3:60109102-60109124 CTCTAGATGCTGTAAAAGAGGGG + Intronic
957344754 3:78946334-78946356 CTCTACAAGCTAGAGGAGAGTGG + Intronic
958414302 3:93855561-93855583 CTTTATAAGGAGAGGAAGAGAGG - Intergenic
958797251 3:98718715-98718737 CTTTAGAAGCTGAAGAAGGCAGG + Intergenic
959166935 3:102792242-102792264 CTCTATCAGCTGAAAGACAGAGG - Intergenic
959321527 3:104881782-104881804 CTCTCCAAGCTGAAGAGAAGAGG - Intergenic
959731317 3:109605770-109605792 ATCTTTGAGCTGAAGAAGAAAGG - Intergenic
959739337 3:109698034-109698056 CTTTATTAACTGAAGAAAAGTGG + Intergenic
960363542 3:116743541-116743563 CTCTAAAAGTTGAAGAAGAATGG + Intronic
960448742 3:117779778-117779800 CTCTACAAGCCGGAAAAGAGTGG + Intergenic
961376519 3:126469713-126469735 CGCGGTCAGCTGAAGAAGAGGGG - Intronic
962150830 3:132891698-132891720 CTGTAAAAGCTGGAAAAGAGAGG + Intergenic
963450104 3:145468648-145468670 CTCCTTAAGCAGAAAAAGAGTGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963724793 3:148908012-148908034 CTCTTAATGATGAAGAAGAGGGG + Intergenic
963921371 3:150909141-150909163 CTCTATAAGTCAAAGAAGTGTGG - Intronic
964033418 3:152166626-152166648 CTCTATAAGCCAAAAGAGAGTGG - Intergenic
964372849 3:156019175-156019197 TTCTATACTCTGAAGGAGAGAGG + Intergenic
965327455 3:167324763-167324785 CTCTATAGGCTGAAGATGACTGG - Intronic
965340890 3:167489711-167489733 CTATATCAGCTGAACAACAGTGG + Intronic
965634593 3:170768514-170768536 CTCTGTAAGCTGAGGATGATAGG - Intronic
967839105 3:193990384-193990406 CTTTATAAGAAGAAGAAGAGAGG - Intergenic
968381199 4:97821-97843 CTATATAACCTAAAGAAGATTGG - Intergenic
969233503 4:5848819-5848841 CTTTATAAGGAGAAGAAGAGAGG - Intronic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
970705405 4:18795573-18795595 TTTTATAAGGAGAAGAAGAGAGG - Intergenic
970926716 4:21460607-21460629 CTTTATAAGAAGAGGAAGAGAGG - Intronic
972364520 4:38361760-38361782 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
974810363 4:66937962-66937984 TTCTATAAGATAAAAAAGAGAGG + Intergenic
977904739 4:102463303-102463325 CTTTATAAGCTAAATAAGAAAGG - Intergenic
981846715 4:149177657-149177679 CTCTATAAGCCAGAGGAGAGTGG + Intergenic
983634519 4:169883522-169883544 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
983919507 4:173330995-173331017 CTCTTTAATGGGAAGAAGAGGGG - Intergenic
984369982 4:178851131-178851153 CTCTATCAGCTGCAGATGACAGG - Intergenic
985150580 4:186943269-186943291 GACTATAAGCAGAGGAAGAGTGG + Intergenic
985332548 4:188855388-188855410 CTATATAAATTGCAGAAGAGAGG + Intergenic
985832745 5:2247471-2247493 AAATATAAGATGAAGAAGAGAGG - Intergenic
986396455 5:7335588-7335610 CTTTATAAGGAGAGGAAGAGAGG - Intergenic
987415994 5:17662872-17662894 CTCTGTCAGCTGTAGAACAGAGG + Intergenic
987454064 5:18121171-18121193 CTCTATAAGCTGGAGGAGATTGG + Intergenic
988443934 5:31263581-31263603 CTTTATAAGAAGAGGAAGAGAGG - Intronic
988999128 5:36742891-36742913 CTCTGGAAGCTGGAGAAGAAAGG + Intergenic
992878652 5:81083046-81083068 TTCTAGAAGCTGAAGCTGAGAGG + Intronic
993291099 5:86071675-86071697 TTCTATCAGCTGAAGAAGTGAGG + Intergenic
993778002 5:92026086-92026108 GTCTATAATCTGAGGAAGGGTGG + Intergenic
993802983 5:92367633-92367655 ATATATAGGCTGAAGAGGAGAGG + Intergenic
994898384 5:105736413-105736435 CTTTATAATCTGCAAAAGAGAGG - Intergenic
994975549 5:106800008-106800030 CTGAATAAGATGAGGAAGAGAGG - Intergenic
995178984 5:109212791-109212813 CTCTATAAGCCAGAAAAGAGTGG - Intergenic
996520961 5:124424947-124424969 CTCTATAAGCCAAAAGAGAGTGG + Intergenic
999537672 5:152535308-152535330 CTTTATAAGAGGAGGAAGAGAGG + Intergenic
1004706853 6:18132524-18132546 CTCTATATCCTGCAGCAGAGCGG - Intronic
1004842785 6:19606125-19606147 CTAGATAAACTGAAGAACAGAGG + Intergenic
1005667145 6:28069553-28069575 CTCTATAGGCTGAATAAAAGAGG - Intergenic
1006206749 6:32350927-32350949 CTCTAGAAGCTGAAAAAGCAAGG + Intronic
1007859444 6:44892283-44892305 CTTTATAAGATGAGGAAGAGAGG + Intronic
1009596595 6:65744977-65744999 CTCTATCAGCTGGAGAACACTGG - Intergenic
1013707465 6:112854975-112854997 CCCTAAAAGCAGAAGATGAGTGG + Intergenic
1014756324 6:125305174-125305196 CTCTAAAAGCTGAAAAAGACAGG + Intergenic
1016172255 6:141032532-141032554 CTCTATTCTCTAAAGAAGAGAGG - Intergenic
1016659861 6:146565824-146565846 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
1017410377 6:154161691-154161713 TTCTTTAAGCTTTAGAAGAGGGG - Intronic
1017472983 6:154758704-154758726 CTCTATTATCCAAAGAAGAGGGG - Intronic
1017602917 6:156102978-156103000 ATGTATAAGGGGAAGAAGAGTGG - Intergenic
1017617372 6:156259681-156259703 CTCTATGAGATGAATAATAGTGG - Intergenic
1018626287 6:165781804-165781826 CTCAAGAAGCTGGAGAAGTGGGG + Intronic
1018809665 6:167288961-167288983 CTCTATCAGCTTGAGAAAAGAGG - Intronic
1018900569 6:168049854-168049876 CGCTACAAGCTGAAGAGGACAGG - Intergenic
1019214370 6:170433836-170433858 CTCTAGAAGCTGGAAAAGACAGG + Intergenic
1022163510 7:27735315-27735337 CTCAGTAAGATGAGGAAGAGAGG + Intergenic
1022600592 7:31755348-31755370 CTCTATCAGCTGAAGGGGAGGGG + Intronic
1022804296 7:33806632-33806654 CTCTTTAAAATGAACAAGAGTGG + Intergenic
1023507645 7:40917429-40917451 CTCTAGAAGTTCAAGATGAGAGG + Intergenic
1024849014 7:53687557-53687579 CTCTAAAAGGTGAAAATGAGAGG + Intergenic
1025003447 7:55337306-55337328 CTCCATAAGCAGAAGAGCAGGGG - Intergenic
1027627726 7:80565239-80565261 CTCTGTCAGCTGGAGAAGACTGG + Intronic
1030996885 7:116370507-116370529 CTTTATAAGAAGAAGAAGAGAGG + Intronic
1031898571 7:127383994-127384016 CTCTCTGAGCTAAAGAAGTGAGG - Intronic
1032510792 7:132470799-132470821 CTTTAGAAGCTGAAAAAGACAGG + Intronic
1034000424 7:147406376-147406398 ATCTATAAGCTGAAAAGAAGAGG + Intronic
1034009975 7:147519217-147519239 CTCCAGAAGCTGAAAAAGAATGG - Intronic
1034074944 7:148222419-148222441 GTCTATAAGAAGAGGAAGAGAGG - Intronic
1034942054 7:155237065-155237087 GGCTACAAGCAGAAGAAGAGGGG - Intergenic
1036048762 8:5172728-5172750 CACCATAAGCTGAAGGAGACTGG + Intergenic
1036261260 8:7242199-7242221 ATCTGTAAACTGAAAAAGAGTGG - Intergenic
1036305341 8:7597351-7597373 ATCTGTAAACTGAAAAAGAGTGG + Intergenic
1036313300 8:7700743-7700765 ATCTGTAAACTGAAAAAGAGTGG - Intergenic
1036356192 8:8045348-8045370 ATCTGTAAACTGAAAAAGAGTGG + Intergenic
1037939048 8:22937059-22937081 CTATATATGTTGAATAAGAGTGG - Intronic
1039306354 8:36267517-36267539 CTCCATGAGCCGAAGAACAGAGG - Intergenic
1039361935 8:36885923-36885945 CTGTATCACCTGAAGAAGAAAGG + Intronic
1039810478 8:41043857-41043879 CCCTAGTAGCTGAAGAAGAAGGG - Intergenic
1039822757 8:41148178-41148200 TTCTAGAAGAAGAAGAAGAGAGG + Intergenic
1040046328 8:42967580-42967602 CTCTTTAATCTTAAAAAGAGAGG + Intronic
1040915014 8:52560030-52560052 CTCTTTAAGTTGAAGACTAGGGG - Intronic
1042682105 8:71397618-71397640 CTCTATAAGCCAAAAGAGAGTGG - Intergenic
1042771664 8:72388978-72389000 TTCTAAAGGCTAAAGAAGAGAGG - Intergenic
1046099136 8:109594363-109594385 CTCACTGAGATGAAGAAGAGTGG - Intronic
1046167747 8:110460412-110460434 GTCTAGAAGCTCAAGAAAAGTGG + Intergenic
1047208315 8:122820689-122820711 TTTTATAAGCTGAATAAGAATGG + Intronic
1048667931 8:136685080-136685102 CCCTAAAAACTGAAGAAGATAGG + Intergenic
1050258617 9:3817916-3817938 ATCCATAAGGAGAAGAAGAGTGG + Intergenic
1050560175 9:6827111-6827133 CTCAAGAAGCTGCAGAAGAATGG - Intronic
1052140077 9:24970328-24970350 TTGTGTAGGCTGAAGAAGAGGGG - Intergenic
1052591996 9:30509834-30509856 CTATCTAAGCTGAAATAGAGAGG + Intergenic
1052994076 9:34540608-34540630 CTCTGTAAGCTGGGGAAGATGGG - Intergenic
1054997528 9:71408916-71408938 CTCTACAAGCCAAAAAAGAGTGG + Intronic
1055571966 9:77625547-77625569 CTCTATAAGCCAAAAGAGAGTGG + Intronic
1057261862 9:93589021-93589043 CTCCATCAAGTGAAGAAGAGAGG + Intronic
1059483880 9:114612274-114612296 CTCTACGGGCTGAAAAAGAGGGG + Intronic
1061151874 9:128833409-128833431 TTCTCTAAGATGAAGAAGGGCGG + Exonic
1185961804 X:4552777-4552799 CTCTATGAGCAGAAGAGCAGAGG - Intergenic
1189606303 X:42681855-42681877 TCCTAGAAGCGGAAGAAGAGAGG + Intergenic
1190139889 X:47833550-47833572 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1190995513 X:55604846-55604868 CTCTACAAGCTGGAACAGAGTGG - Intergenic
1191928196 X:66339050-66339072 TTGTATAAGGTGAAGAAAAGTGG + Intergenic
1193283952 X:79689592-79689614 ATATATAGGCTGGAGAAGAGTGG - Intergenic
1193732314 X:85116077-85116099 CTCTATAAAGTGAAGTGGAGAGG + Intergenic
1194812038 X:98398919-98398941 CCCTATAAGAAGAGGAAGAGAGG + Intergenic
1195261981 X:103141579-103141601 CTACATAAGATAAAGAAGAGGGG + Intergenic
1195622758 X:106973807-106973829 CTCTATAAGCTGGAAAAGACAGG + Intronic
1196621686 X:117831768-117831790 CTCTACAAGCCAAAGGAGAGTGG - Intergenic
1197109842 X:122759124-122759146 CACTATATGTTGAATAAGAGTGG + Intergenic
1197808036 X:130416051-130416073 ATCTACAAGCTGAAGAGGAGTGG - Intergenic
1199735331 X:150680720-150680742 CTCTAGAAGCTGGAAAAGACAGG + Intergenic
1199759035 X:150891355-150891377 CTCTAGAAGCTGGAAAAGACAGG - Intronic
1200291335 X:154877457-154877479 CTCTAGAAGCTGGAAAAGAAAGG + Intronic