ID: 1114608899

View in Genome Browser
Species Human (GRCh38)
Location 14:24022872-24022894
Sequence GTGCAATAAAAAATGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114608895_1114608899 11 Left 1114608895 14:24022838-24022860 CCAATAAAGAAGAAAAGAGAGAA 0: 88
1: 62
2: 53
3: 509
4: 9592
Right 1114608899 14:24022872-24022894 GTGCAATAAAAAATGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114608899 Original CRISPR GTGCAATAAAAAATGATGGA GGG Intergenic
No off target data available for this crispr