ID: 1114611084

View in Genome Browser
Species Human (GRCh38)
Location 14:24041107-24041129
Sequence TGTGCTCCGGATTTGGCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114611084_1114611092 16 Left 1114611084 14:24041107-24041129 CCGTGGGCCAAATCCGGAGCACA No data
Right 1114611092 14:24041146-24041168 CATGTACTGCTACTTGCCCAAGG No data
1114611084_1114611088 -9 Left 1114611084 14:24041107-24041129 CCGTGGGCCAAATCCGGAGCACA No data
Right 1114611088 14:24041121-24041143 CGGAGCACAAAATTGACCAAGGG No data
1114611084_1114611087 -10 Left 1114611084 14:24041107-24041129 CCGTGGGCCAAATCCGGAGCACA No data
Right 1114611087 14:24041120-24041142 CCGGAGCACAAAATTGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114611084 Original CRISPR TGTGCTCCGGATTTGGCCCA CGG (reversed) Intergenic
No off target data available for this crispr