ID: 1114611092

View in Genome Browser
Species Human (GRCh38)
Location 14:24041146-24041168
Sequence CATGTACTGCTACTTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114611081_1114611092 21 Left 1114611081 14:24041102-24041124 CCCCTCCGTGGGCCAAATCCGGA No data
Right 1114611092 14:24041146-24041168 CATGTACTGCTACTTGCCCAAGG No data
1114611083_1114611092 19 Left 1114611083 14:24041104-24041126 CCTCCGTGGGCCAAATCCGGAGC No data
Right 1114611092 14:24041146-24041168 CATGTACTGCTACTTGCCCAAGG No data
1114611084_1114611092 16 Left 1114611084 14:24041107-24041129 CCGTGGGCCAAATCCGGAGCACA No data
Right 1114611092 14:24041146-24041168 CATGTACTGCTACTTGCCCAAGG No data
1114611085_1114611092 9 Left 1114611085 14:24041114-24041136 CCAAATCCGGAGCACAAAATTGA No data
Right 1114611092 14:24041146-24041168 CATGTACTGCTACTTGCCCAAGG No data
1114611082_1114611092 20 Left 1114611082 14:24041103-24041125 CCCTCCGTGGGCCAAATCCGGAG No data
Right 1114611092 14:24041146-24041168 CATGTACTGCTACTTGCCCAAGG No data
1114611086_1114611092 3 Left 1114611086 14:24041120-24041142 CCGGAGCACAAAATTGACCAAGG No data
Right 1114611092 14:24041146-24041168 CATGTACTGCTACTTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114611092 Original CRISPR CATGTACTGCTACTTGCCCA AGG Intergenic
No off target data available for this crispr