ID: 1114612710

View in Genome Browser
Species Human (GRCh38)
Location 14:24052797-24052819
Sequence TACCCACCACCCACACATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 5, 3: 7, 4: 205}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114612702_1114612710 10 Left 1114612702 14:24052764-24052786 CCACAGCCCCGTCCCAGCCTGCT 0: 1
1: 0
2: 9
3: 120
4: 812
Right 1114612710 14:24052797-24052819 TACCCACCACCCACACATCAAGG 0: 1
1: 0
2: 5
3: 7
4: 205
1114612708_1114612710 -7 Left 1114612708 14:24052781-24052803 CCTGCTTCCTTCTCGCTACCCAC 0: 1
1: 0
2: 0
3: 21
4: 271
Right 1114612710 14:24052797-24052819 TACCCACCACCCACACATCAAGG 0: 1
1: 0
2: 5
3: 7
4: 205
1114612705_1114612710 2 Left 1114612705 14:24052772-24052794 CCGTCCCAGCCTGCTTCCTTCTC 0: 1
1: 2
2: 7
3: 225
4: 1992
Right 1114612710 14:24052797-24052819 TACCCACCACCCACACATCAAGG 0: 1
1: 0
2: 5
3: 7
4: 205
1114612704_1114612710 3 Left 1114612704 14:24052771-24052793 CCCGTCCCAGCCTGCTTCCTTCT 0: 1
1: 1
2: 7
3: 92
4: 835
Right 1114612710 14:24052797-24052819 TACCCACCACCCACACATCAAGG 0: 1
1: 0
2: 5
3: 7
4: 205
1114612707_1114612710 -3 Left 1114612707 14:24052777-24052799 CCAGCCTGCTTCCTTCTCGCTAC 0: 1
1: 0
2: 1
3: 36
4: 348
Right 1114612710 14:24052797-24052819 TACCCACCACCCACACATCAAGG 0: 1
1: 0
2: 5
3: 7
4: 205
1114612701_1114612710 11 Left 1114612701 14:24052763-24052785 CCCACAGCCCCGTCCCAGCCTGC 0: 1
1: 1
2: 3
3: 77
4: 581
Right 1114612710 14:24052797-24052819 TACCCACCACCCACACATCAAGG 0: 1
1: 0
2: 5
3: 7
4: 205
1114612703_1114612710 4 Left 1114612703 14:24052770-24052792 CCCCGTCCCAGCCTGCTTCCTTC 0: 1
1: 1
2: 3
3: 57
4: 638
Right 1114612710 14:24052797-24052819 TACCCACCACCCACACATCAAGG 0: 1
1: 0
2: 5
3: 7
4: 205
1114612700_1114612710 14 Left 1114612700 14:24052760-24052782 CCTCCCACAGCCCCGTCCCAGCC 0: 1
1: 0
2: 14
3: 156
4: 1279
Right 1114612710 14:24052797-24052819 TACCCACCACCCACACATCAAGG 0: 1
1: 0
2: 5
3: 7
4: 205
1114612706_1114612710 -2 Left 1114612706 14:24052776-24052798 CCCAGCCTGCTTCCTTCTCGCTA 0: 1
1: 0
2: 2
3: 31
4: 232
Right 1114612710 14:24052797-24052819 TACCCACCACCCACACATCAAGG 0: 1
1: 0
2: 5
3: 7
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114612710 Original CRISPR TACCCACCACCCACACATCA AGG Intronic
900314851 1:2051420-2051442 TCCCCACCGCCCACACTTCGGGG - Intronic
900327172 1:2114021-2114043 CACGCACCACACACACAACATGG - Intronic
902275754 1:15338131-15338153 CCCCCACCACCCCCACATCCCGG + Intronic
904042855 1:27594231-27594253 TACCCCCCACCCCCAAATCCAGG - Intronic
907451066 1:54546238-54546260 TGTCCACCCCCCACACAGCAAGG - Intronic
908619376 1:65960324-65960346 TATCCACCACCGACAGATAATGG - Intronic
910671851 1:89781781-89781803 GACCCACCAGCTACAGATCAGGG + Intronic
910863334 1:91764608-91764630 CCCGAACCACCCACACATCAGGG - Intronic
910936865 1:92491008-92491030 TACCCACTTCCCACAAATGATGG - Intergenic
911360770 1:96873457-96873479 TCCCCACCTCCCACACAACTGGG - Intergenic
917030911 1:170690477-170690499 TACGCACCACACACACCTGAAGG - Intronic
920232626 1:204480674-204480696 AGCCCACCACCCACACAGCCTGG - Intronic
920856491 1:209666840-209666862 TAGCCACCAACCACACATAGGGG + Intergenic
922792257 1:228316976-228316998 CGCCCACCACCCACCCAGCACGG - Exonic
923538055 1:234868344-234868366 GGCCCACAACCCACACATGATGG + Intergenic
923787408 1:237081400-237081422 TACCCATGGCCCACACTTCAGGG + Intronic
1065656411 10:27956121-27956143 TACCCCTCACCAACCCATCATGG + Intronic
1066492945 10:35911995-35912017 TACCCTCCACCCTCACATACGGG - Intergenic
1067722567 10:48740315-48740337 AAACCACCACACACACGTCAAGG + Intronic
1073643149 10:105273507-105273529 TCCCCACCTCACACTCATCAAGG + Intergenic
1074068280 10:110038979-110039001 TACCCTCCAAACACACATAAAGG - Intronic
1075054177 10:119206141-119206163 TACCCACCACCACCACTTCCTGG - Intergenic
1075727676 10:124618849-124618871 CCCCCACCACCCACCCACCAGGG - Intronic
1076373173 10:129967730-129967752 TACCCACTACCCACCCGTGAAGG + Intergenic
1076390491 10:130097474-130097496 TGCCCACCACCAACATATGAGGG - Intergenic
1076729669 10:132432093-132432115 CACCAACCACCCAGACAGCAGGG + Intergenic
1077602222 11:3581560-3581582 TTCCCACCACCTCCAAATCATGG - Intergenic
1077881890 11:6357332-6357354 TCTCCACCACCCACACACAATGG - Intergenic
1078284417 11:9936989-9937011 CTCCCAACACCAACACATCAGGG + Intronic
1080404897 11:31970441-31970463 TATCAACCTCCCACACTTCACGG + Intronic
1083343732 11:61975288-61975310 TACCCACCTCCCCCACAGCAAGG + Intergenic
1084577211 11:69997060-69997082 CACCCACCACCCACAACCCAGGG - Intergenic
1087367722 11:97242317-97242339 TACCCCCAACACACACACCATGG - Intergenic
1092429446 12:8397063-8397085 TTCCCACCACCTCCAAATCATGG - Intergenic
1093625024 12:21335723-21335745 TCCCAAACACACACACATCAAGG + Intronic
1093979767 12:25463407-25463429 TAACTACCACCCACACATTTAGG - Intronic
1094417177 12:30229685-30229707 TACCCATCATCTTCACATCAAGG - Intergenic
1095971397 12:47904290-47904312 TCACCACCACCCACAGATCCAGG + Intronic
1096487746 12:51995033-51995055 CACCCACCACCCTCACATTTTGG - Intronic
1096985327 12:55752359-55752381 CACCCACCACACACACACAAAGG - Exonic
1100516657 12:95334529-95334551 TACCGAACACCCAGACAGCATGG - Intergenic
1100933740 12:99639544-99639566 TTCCCACAACCCCCACGTCATGG + Intronic
1102203296 12:111073183-111073205 TACCAACCACCCACCCCCCAGGG + Intronic
1102562816 12:113774574-113774596 TACCAACCTCACACACTTCAGGG + Intergenic
1103591734 12:121996030-121996052 TACCCTTCACCCTCACATCTTGG - Intronic
1104748205 12:131222987-131223009 CACCCACCTCCCACCCAGCAAGG - Intergenic
1105255375 13:18740977-18740999 TACCCACCAGTCACTCCTCAGGG + Intergenic
1105445875 13:20456751-20456773 TGCCCACCCCCCACTCTTCATGG + Intronic
1106182875 13:27383449-27383471 TTCCCAGCACCCCCATATCAAGG - Intergenic
1107472058 13:40700121-40700143 TCCCAACCCCCCAAACATCATGG + Intergenic
1107990602 13:45815722-45815744 TACCCAGCCCTCTCACATCATGG - Intronic
1108066120 13:46579022-46579044 CTCCCACCACCTACACACCAGGG - Intronic
1111090062 13:83434268-83434290 TACCCACCAAACACAAAACAGGG - Intergenic
1113467762 13:110524248-110524270 TAGCCACCAGCCACACTGCAAGG + Intronic
1113607606 13:111621761-111621783 CACACACCACACACACACCACGG - Intronic
1114612710 14:24052797-24052819 TACCCACCACCCACACATCAAGG + Intronic
1118886738 14:69873576-69873598 TACCCTCCACCCTCATAACAAGG + Intronic
1119084805 14:71730086-71730108 TCCCCAGCACCCCCACCTCACGG + Exonic
1120925469 14:89793302-89793324 TAACCAGCAGCCAAACATCATGG + Intergenic
1121538886 14:94710690-94710712 TACCCCCCACCCGCCCACCAGGG + Intergenic
1126104408 15:45138244-45138266 AACCCACCACCCCAACCTCAGGG + Intronic
1129453607 15:75664238-75664260 TACCCACCACCTGCCCCTCACGG - Intergenic
1131353956 15:91726964-91726986 TCCCCACCACCCACCCACAAGGG + Intergenic
1132281346 15:100618607-100618629 CACACACCACACACACAGCAGGG - Intronic
1132354271 15:101159576-101159598 CACCCTCCACCCACACCTCCGGG - Intergenic
1136394849 16:29987245-29987267 GACCCACCAGCCCCACCTCAAGG - Exonic
1137512996 16:49117649-49117671 TCCCTACCACCCAGACACCAAGG + Intergenic
1138779513 16:59765773-59765795 TACCCAGCACCCACTCAAAATGG + Intergenic
1141158080 16:81610666-81610688 TACATACCACCCATGCATCACGG - Intronic
1141287473 16:82685913-82685935 TGGCCGCCACCCACATATCATGG + Intronic
1143226113 17:5305093-5305115 TAGCAACCAACCACAAATCAAGG - Intronic
1146480718 17:33202857-33202879 TATCCACCACCCACTCCTGAAGG - Intronic
1147133007 17:38419869-38419891 TCCCCTCCCCCTACACATCAAGG + Intergenic
1150513167 17:65777549-65777571 TACCCACACCCTACACACCAAGG + Intronic
1150640322 17:66945356-66945378 ATCCCACCCCCCACACAGCAGGG - Intergenic
1152206241 17:78976198-78976220 CACCCACCGCCCACACCTCCAGG + Intronic
1152355986 17:79807571-79807593 TACCCACCAACCACTCATCACGG + Intergenic
1154435643 18:14339625-14339647 TACCCACCAGTCACTCCTCAGGG - Intergenic
1154483434 18:14857238-14857260 TCCTCACCTCCCAGACATCACGG + Intergenic
1154483854 18:14858858-14858880 TCCTCACCTCCCAGACATCACGG + Intergenic
1156276591 18:35589298-35589320 CACCCACTTCCCACACACCAGGG - Intronic
1156547940 18:37984378-37984400 TACCCACCACCCACAGTCTAAGG - Intergenic
1157191167 18:45582951-45582973 TCCTCACCACCCACCCACCAGGG + Intronic
1157517524 18:48321396-48321418 TACCCACCTACCTCACATGATGG + Intronic
1158215660 18:55097973-55097995 TACTCACCAGCCATAAATCATGG + Intergenic
1159057357 18:63479121-63479143 CACTCTTCACCCACACATCACGG - Intronic
1160240347 18:77118331-77118353 CACCCACCACCCTCACAACATGG + Intronic
1160411542 18:78678474-78678496 AACCCACAAGCCCCACATCAAGG + Intergenic
1160460866 18:79037213-79037235 CACCCTCCACCCAGGCATCATGG + Intergenic
1160796935 19:949980-950002 TGCCTACCTCCCACCCATCAAGG - Intronic
1163234006 19:16020640-16020662 GACCAACCACTCACACAGCAGGG - Intergenic
1164771192 19:30810483-30810505 TTCTCACAACCCACAGATCATGG + Intergenic
1165344237 19:35233808-35233830 TACCCTCCCCACACACAACAAGG - Intergenic
1166851461 19:45763442-45763464 CACCCCCCACCCACACCTCGGGG - Intronic
1167752166 19:51387778-51387800 TACCCACCACCCAGGAATCCAGG - Intronic
1168403061 19:56097144-56097166 TTCCCAGCACCCAGACCTCATGG + Intronic
927884628 2:26710802-26710824 GACCCAACACCCAGACACCACGG + Intronic
932471940 2:71965087-71965109 CACCCACCCCACACACATCTGGG + Intergenic
933652416 2:84860075-84860097 TCCCCACCACACACGCATCAAGG + Intronic
934654638 2:96110800-96110822 CACCCACCACCCTCACCTCCAGG + Intergenic
936286250 2:111183576-111183598 TACCCTCCACCCTTACCTCAGGG + Intergenic
939259080 2:139783661-139783683 TTCCCACCAACCACATATGAGGG - Intergenic
940634856 2:156286574-156286596 TACCCAACACCAGCACATAATGG + Intergenic
940892321 2:159047056-159047078 CAGCCACCATCCACACTTCATGG + Intronic
941040695 2:160619605-160619627 TTCCCATCCCCCACACCTCAGGG - Intergenic
941488276 2:166109854-166109876 TCCCCACCACCCACATAGTAGGG - Intronic
944508769 2:200443817-200443839 TACCAAGCAAGCACACATCAAGG + Intronic
946056973 2:216911119-216911141 TAACCACCACCAACATAGCAAGG - Intergenic
946150543 2:217764357-217764379 ACCCCACCACACACACACCATGG - Intergenic
948502566 2:238406109-238406131 TGCCCACCACCCACAAAACTGGG - Intergenic
948678031 2:239610587-239610609 CACCCATCACCTCCACATCAAGG - Intergenic
1171150211 20:22821059-22821081 TAGCCCCCACCCACACACTATGG + Intergenic
1171880184 20:30612929-30612951 TACCCACCAGTCACTCCTCAGGG + Intergenic
1172463512 20:35137734-35137756 TACCCACCAGGCACCCACCATGG - Intronic
1174708893 20:52684650-52684672 AATCCACCACCCACAAATCTGGG - Intergenic
1174718562 20:52786308-52786330 TCACCACCACCCACACACCTTGG - Intergenic
1175470530 20:59223965-59223987 CATCCACCACCCCCACATCCAGG + Intronic
1175734694 20:61377053-61377075 CACCCACCACCAACACGTGAGGG + Intronic
1176152949 20:63602354-63602376 CACCCAGCACGCACACCTCAAGG + Intronic
1176388732 21:6152550-6152572 TGCACACCACACACACACCAGGG + Intergenic
1176388764 21:6152700-6152722 CACACACCACACACACACCAGGG + Intergenic
1176841392 21:13846006-13846028 TACCCACCAGTCACTCCTCAGGG + Intergenic
1179664444 21:42900582-42900604 TACCAACTACCAACACTTCAGGG - Intronic
1179734708 21:43385548-43385570 CACACACCACACACACACCAGGG - Intergenic
1179734740 21:43385698-43385720 TGCACACCACACACACACCAGGG - Intergenic
1182840761 22:33387844-33387866 TACCCACCACCTAGATATAATGG + Intronic
1183298296 22:37045015-37045037 AACCAAACACCCCCACATCAAGG + Intergenic
1183766266 22:39878429-39878451 TATACACTAACCACACATCAAGG + Intronic
949970291 3:9397831-9397853 TGCCCCCCACCCCCACCTCACGG + Exonic
952178149 3:30889265-30889287 TTCCCATAATCCACACATCATGG - Intronic
952273362 3:31853783-31853805 GCTGCACCACCCACACATCAGGG + Intronic
952818965 3:37469377-37469399 CACCCACCACACACACAGCATGG - Intronic
953412121 3:42696575-42696597 TTCCCAACACCCACAGTTCATGG + Intronic
954302202 3:49705969-49705991 CACCCACCATCTACACAGCATGG - Exonic
954419685 3:50412238-50412260 TGCCCACAACCCCCACATCTGGG + Intronic
954487024 3:50862468-50862490 TTTCCACCAACCCCACATCAAGG - Intronic
954558281 3:51535380-51535402 CACCCACCAGCCACACTTAATGG - Intergenic
954984411 3:54776836-54776858 TTCCCACCACCCACACAGCAGGG - Intronic
955215844 3:56984374-56984396 TACCAACCATCCATCCATCATGG - Intronic
961281016 3:125766154-125766176 TTCCCACCACCTCCAAATCATGG + Intergenic
961541341 3:127601793-127601815 TTCCCACCAGCAACACATGAGGG + Intronic
961873376 3:130003431-130003453 TTCCCACCACCTCCAAATCATGG - Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
966155386 3:176910712-176910734 TACCCATACCCCACATATCAAGG + Intergenic
966423264 3:179754985-179755007 AACCCACCACCGACACAGGAGGG + Intronic
966911778 3:184563900-184563922 CACCCACCACACCCACAACAAGG - Intronic
967460178 3:189737135-189737157 TAAGAACCACCCACACATCAAGG + Intronic
968960580 4:3741192-3741214 GACCCACCGGCCTCACATCAGGG - Intergenic
968963012 4:3754898-3754920 GTCCCACCTCCCTCACATCACGG - Intergenic
969375811 4:6762484-6762506 GACCCAGAACCCACACCTCATGG - Intergenic
969975091 4:11091080-11091102 TACCCAGCACATACACAGCATGG + Intergenic
975941543 4:79653564-79653586 AACCAACCACCCACAACTCAGGG + Intergenic
981591337 4:146366092-146366114 TACCCACCAGCCTCACCCCATGG + Intronic
987059300 5:14226762-14226784 TACCCAGCACCTCCACTTCAGGG - Intronic
989429971 5:41341674-41341696 TATCCACCACCCACCCTTTATGG - Intronic
990237629 5:53784568-53784590 CACCCCCCACCCCCACACCAAGG - Intergenic
991638786 5:68733096-68733118 TACCCTCCACCTATCCATCAGGG - Intergenic
997196878 5:131986181-131986203 TGCCCATCTCCTACACATCACGG - Intronic
997819683 5:137053649-137053671 GACCCACCCCCCACCCATTAAGG - Intronic
998636435 5:143959977-143959999 TGCCCACCAGACACAAATCATGG - Intergenic
1003414464 6:5895601-5895623 TCCCCACCACCAACCCATGATGG + Intergenic
1005054004 6:21712511-21712533 TACCCACAGCCCACAAATCCAGG - Intergenic
1005754323 6:28911943-28911965 TACCCACCATCCACTGGTCAAGG + Intronic
1007600075 6:43076082-43076104 TACCCACCACCGACTCTGCAGGG - Intergenic
1007626602 6:43250045-43250067 CACCCACCCCCCACCCATTATGG - Intronic
1007709255 6:43811462-43811484 TACCCCCCTCCCACTCAGCAGGG + Intergenic
1008136927 6:47787752-47787774 TACCCAATACCCAGACTTCAAGG - Intronic
1013944733 6:115707997-115708019 TACCCACCACCCACACCCCAAGG + Intergenic
1014711937 6:124816631-124816653 TCCCCACTACACAGACATCACGG + Intronic
1018676821 6:166229471-166229493 CTCCCCCCACCCACACAGCATGG - Intergenic
1020274226 7:6615286-6615308 TACCCCCCACCCAGACACCCAGG + Intergenic
1022258574 7:28682989-28683011 TACCCACCACCCTCTCCCCAAGG + Intronic
1023021253 7:36013782-36013804 TTCCCACCAGCAACACATGAGGG + Intergenic
1023720609 7:43089809-43089831 TATCCACCTCCCCCACATCTTGG - Intergenic
1027427996 7:78081486-78081508 TACCCACCACCCCCACTTTCTGG - Intronic
1030613675 7:111715803-111715825 GAGACACTACCCACACATCAGGG + Intergenic
1033475591 7:141689006-141689028 TACCCACACGCCACACATTACGG + Intronic
1035340597 7:158158360-158158382 TTCCCACCACCAACACGACAAGG + Intronic
1035463331 7:159060043-159060065 TACCCACCACCCTCACCTCACGG + Intronic
1036258405 8:7222354-7222376 TTCCCACCACCTCCAAATCATGG - Intergenic
1036259465 8:7228498-7228520 TTCCCACCACCTCCAAATCATGG - Intergenic
1036307160 8:7611026-7611048 TTCCCACCACCTCCAAATCATGG + Intergenic
1036311507 8:7687068-7687090 TTCCCACCACCTCCAAATCATGG - Intergenic
1036358003 8:8059013-8059035 TTCCCACCACCTCCAAATCATGG + Intergenic
1036359076 8:8065155-8065177 TTCCCACCACCTCCAAATCATGG + Intergenic
1036830350 8:12015472-12015494 TTCCCACCACCTCCAAATCATGG - Exonic
1036891882 8:12601797-12601819 TTCCCACCACCTCCAAATCATGG - Intergenic
1036892946 8:12607933-12607955 TTCCCACCACCTCCAAATCATGG - Intergenic
1036900498 8:12665919-12665941 TTCCCACCACCTCCAAATCATGG - Intergenic
1037709713 8:21346008-21346030 TACCTATCTTCCACACATCATGG - Intergenic
1038042135 8:23732476-23732498 CAGCCAAGACCCACACATCATGG - Intergenic
1042268752 8:66935170-66935192 AACCCACCACAAACAAATCAGGG - Intergenic
1043737444 8:83766385-83766407 TACACACCATACACACTTCAAGG + Intergenic
1047670474 8:127141040-127141062 CACTCACCCCCCACACACCAAGG - Intergenic
1048818720 8:138359417-138359439 TACCCACCTACCATTCATCATGG + Intronic
1051883986 9:21870506-21870528 TTCTCACCTCCCACACCTCATGG + Intronic
1053383428 9:37667744-37667766 TGCAAACCACCCACACTTCATGG + Intronic
1053667617 9:40327186-40327208 TACCCACCAGTCACTCCTCAGGG - Intronic
1053917195 9:42952295-42952317 TACCCACCAGTCACTCCTCAGGG - Intergenic
1054378758 9:64467225-64467247 TACCCACCAGTCACTCCTCAGGG - Intergenic
1054516994 9:66049097-66049119 TACCCACCAGTCACTCCTCAGGG + Intergenic
1056216751 9:84412246-84412268 TACCCTCTACTCACATATCAAGG - Intergenic
1057142676 9:92737065-92737087 TGCCCACCACCCCCATCTCAGGG + Intronic
1057151979 9:92804147-92804169 TACACTCCACACACACACCATGG - Intergenic
1059383798 9:113948758-113948780 TAGCCACCACCACAACATCAGGG - Intronic
1060593831 9:124836081-124836103 GGCCCACCACCCACACATCAAGG + Intergenic
1061817458 9:133205580-133205602 TCCCCACCATCCACCCACCAAGG - Exonic
1062242947 9:135549646-135549668 TCCCCCCCACCCACTCACCAAGG + Exonic
1062377002 9:136266376-136266398 CATCCACCCCCCACCCATCATGG + Intergenic
1062461572 9:136664621-136664643 TTCCCAGCCCCCAGACATCAGGG + Intronic
1062474461 9:136720332-136720354 TCCCCGCCCCCCACACACCAAGG - Intronic
1062724303 9:138062728-138062750 TACCTACCACATACACATCAAGG + Intronic
1185622875 X:1464341-1464363 TGCTCACCACCCACACAGCAGGG + Exonic
1186972210 X:14859923-14859945 TCCCCTCCACACCCACATCAGGG - Intronic
1192442377 X:71184114-71184136 TTCACACCAGCCACACATCTGGG + Intergenic
1193140825 X:78024860-78024882 TTCCCACCACCCCTGCATCAGGG + Intronic
1196643570 X:118091824-118091846 TACACAACACACACACACCATGG + Intronic
1198437054 X:136627543-136627565 CACACACAACCCCCACATCAAGG + Intergenic