ID: 1114612754

View in Genome Browser
Species Human (GRCh38)
Location 14:24053047-24053069
Sequence GTGTGTGCACGCGCGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 786
Summary {0: 1, 1: 3, 2: 17, 3: 173, 4: 592}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114612754_1114612758 18 Left 1114612754 14:24053047-24053069 CCAGCACACGCGCGTGCACACAC 0: 1
1: 3
2: 17
3: 173
4: 592
Right 1114612758 14:24053088-24053110 TGGGTGGTTCTGCCAGCAGATGG 0: 1
1: 0
2: 1
3: 27
4: 214
1114612754_1114612757 2 Left 1114612754 14:24053047-24053069 CCAGCACACGCGCGTGCACACAC 0: 1
1: 3
2: 17
3: 173
4: 592
Right 1114612757 14:24053072-24053094 ACACACACACTATATCTGGGTGG 0: 1
1: 0
2: 3
3: 26
4: 280
1114612754_1114612762 26 Left 1114612754 14:24053047-24053069 CCAGCACACGCGCGTGCACACAC 0: 1
1: 3
2: 17
3: 173
4: 592
Right 1114612762 14:24053096-24053118 TCTGCCAGCAGATGGGTATGGGG 0: 1
1: 0
2: 2
3: 25
4: 213
1114612754_1114612761 25 Left 1114612754 14:24053047-24053069 CCAGCACACGCGCGTGCACACAC 0: 1
1: 3
2: 17
3: 173
4: 592
Right 1114612761 14:24053095-24053117 TTCTGCCAGCAGATGGGTATGGG 0: 1
1: 0
2: 2
3: 34
4: 177
1114612754_1114612759 19 Left 1114612754 14:24053047-24053069 CCAGCACACGCGCGTGCACACAC 0: 1
1: 3
2: 17
3: 173
4: 592
Right 1114612759 14:24053089-24053111 GGGTGGTTCTGCCAGCAGATGGG 0: 1
1: 0
2: 1
3: 25
4: 162
1114612754_1114612756 -1 Left 1114612754 14:24053047-24053069 CCAGCACACGCGCGTGCACACAC 0: 1
1: 3
2: 17
3: 173
4: 592
Right 1114612756 14:24053069-24053091 CACACACACACACTATATCTGGG 0: 1
1: 6
2: 57
3: 379
4: 1630
1114612754_1114612755 -2 Left 1114612754 14:24053047-24053069 CCAGCACACGCGCGTGCACACAC 0: 1
1: 3
2: 17
3: 173
4: 592
Right 1114612755 14:24053068-24053090 ACACACACACACACTATATCTGG 0: 1
1: 10
2: 97
3: 661
4: 2781
1114612754_1114612760 24 Left 1114612754 14:24053047-24053069 CCAGCACACGCGCGTGCACACAC 0: 1
1: 3
2: 17
3: 173
4: 592
Right 1114612760 14:24053094-24053116 GTTCTGCCAGCAGATGGGTATGG 0: 1
1: 0
2: 2
3: 17
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114612754 Original CRISPR GTGTGTGCACGCGCGTGTGC TGG (reversed) Intronic
900101921 1:965642-965664 GTGGGTGCACACGCGTGCACTGG + Exonic
900137372 1:1123535-1123557 GTGTGTGCAGGAGTGTGCGCAGG - Intergenic
900137405 1:1123873-1123895 GTGTGCGCAGGAGTGTGTGCAGG - Intergenic
900137410 1:1123930-1123952 GTGTGTGCGCAGGTGTGTGCAGG - Intergenic
900137411 1:1123940-1123962 GTGTGTGCAGGTGTGTGCGCAGG - Intergenic
900137412 1:1123952-1123974 GTGTGTGCAGGAGTGTGTGCAGG - Intergenic
900137439 1:1124200-1124222 GTGTGTCCAGGTGTGTGTGCAGG - Intergenic
900177358 1:1296750-1296772 GCGCGTGTACGTGCGTGTGCGGG - Intronic
900187858 1:1340818-1340840 GTGTGTGCAGGTGTGTGTGCAGG - Intronic
900215485 1:1479409-1479431 GTGTGTGGGCCCGTGTGTGCAGG - Intronic
900215524 1:1479585-1479607 GTATGTGCAGGCCTGTGTGCAGG - Intronic
900215585 1:1479875-1479897 GCGTGTGCATGCCCGTGTGGGGG - Intronic
900222745 1:1518082-1518104 GTGTGTGGGCCCGTGTGTGCAGG - Intronic
900222853 1:1518602-1518624 GGGTGTGTACGCCCGTGTGTGGG - Intronic
900295253 1:1945861-1945883 GTGTGTGCACGTGTGTGTGTGGG + Intronic
900295258 1:1945927-1945949 ATGTGTGCACGTGTGTGTGGGGG + Intronic
900299796 1:1970975-1970997 GTGTGTGTGCACGTGTGTGCAGG - Intronic
900464640 1:2819573-2819595 GTGTGTGCACACAGGTGTGTGGG - Intergenic
900526030 1:3129114-3129136 GAGTGTGCACGTGCGTGTGTGGG + Intronic
900563694 1:3321663-3321685 GTGGGTGCACGTGTGTGTGTGGG + Intronic
900597736 1:3490177-3490199 GTGGGTGCAGGCGCAGGTGCAGG - Exonic
900818955 1:4871568-4871590 GTGTGTGCATGTGTGTGTACAGG - Intergenic
900940336 1:5794428-5794450 GTGTGTGTGTGCACGTGTGCAGG - Intergenic
900978566 1:6033265-6033287 CTGTGTGCATGTGCGTGTGTGGG + Intronic
901205493 1:7492892-7492914 GTGTGTGCACGTGTGTATGTAGG - Intronic
901297790 1:8173903-8173925 GTATGTGCACGTATGTGTGCAGG - Intergenic
901474161 1:9477675-9477697 GTGTATGCATGCGTGTGTGTGGG - Intergenic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
901804620 1:11730391-11730413 GCGTGTGCACGCACATGTGCAGG - Intergenic
902311542 1:15585046-15585068 GAGTGTGCACGCGCCAGAGCCGG + Exonic
902538352 1:17134891-17134913 GTGTGTGCGCGTGCGCATGCGGG - Intergenic
902625858 1:17675964-17675986 GTGTGTGCAAGTGTGGGTGCAGG + Intronic
902625862 1:17675986-17676008 GTGTGTGCAGGTGTGGGTGCAGG + Intronic
902625910 1:17676238-17676260 GTGGGTGCAGGCGTGGGTGCAGG + Intronic
902625927 1:17676333-17676355 GTGGGTGCAGGCGTGGGTGCAGG + Intronic
902690318 1:18107012-18107034 GTGTGTGCTCGCGTGTGTGTTGG + Intergenic
902962350 1:19973852-19973874 GTGTGCACACGTGTGTGTGCGGG + Intergenic
903867304 1:26409271-26409293 GTGTGTGCACGTGCGGATGTGGG - Intergenic
904466850 1:30713362-30713384 GTGTGTGCACGTGCGCCTGAGGG - Exonic
904563701 1:31414613-31414635 GCGTGTGCATGTGCGTGTGCAGG + Intronic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
906798655 1:48717528-48717550 GTGTGTGCGCGCGTGCATGCAGG + Intronic
907460166 1:54601147-54601169 GTGTGTGCATGCATGTGTGTGGG + Intronic
907847214 1:58219694-58219716 GTGTGTGCAGGTGCATGTACAGG - Intronic
908135791 1:61130657-61130679 GTGTGTGCACCTGAGTGTGTGGG + Intronic
912432256 1:109634932-109634954 GTGTGTGCCTGCGTGTGTGAAGG + Intergenic
912466407 1:109877741-109877763 GGGTGTGCACACGGGTGTGCTGG + Intergenic
913244374 1:116858938-116858960 GTGTGCGCACGTGTGTGTGTAGG - Intergenic
915516761 1:156417855-156417877 GTGTGTGCATGTGGGTGTGTGGG - Intronic
915549912 1:156625778-156625800 GTGTGTGCACGCTCATGTCGGGG + Intergenic
915722160 1:157993539-157993561 GTGTGTGCAGGGGCGGGCGCGGG + Intronic
916292171 1:163178702-163178724 GTGTGTGTATGTGTGTGTGCTGG - Intronic
916312044 1:163408565-163408587 GTGTGTGCGTGCGTGTGTGTGGG - Intergenic
916503031 1:165402717-165402739 GTGTGTGAAGGTGTGTGTGCAGG - Intronic
917414781 1:174797545-174797567 GTGTGTGCAGGAGGGTGTGGGGG + Intronic
918306546 1:183251893-183251915 GTGTGTGTATGTGCGTGCGCGGG + Exonic
918594956 1:186282578-186282600 GTGTGTGTGCGTGCGTGTGCTGG + Intergenic
918995793 1:191757538-191757560 GTGTGTGCGCGCGCGTGGGTGGG - Intergenic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920172812 1:204082252-204082274 GTGTGTGCACATATGTGTGCAGG + Intronic
921939264 1:220823271-220823293 GTGTGTGCATGCATGTGTGGGGG + Intergenic
922648722 1:227318513-227318535 GCGTGTGCGCGCGCGTGTGCCGG - Intergenic
922799279 1:228357374-228357396 GTGTGTGCAGGCGGGAGTGATGG + Intronic
922817256 1:228458676-228458698 GTGTGTGTGCGCGCGCGCGCCGG + Exonic
923052301 1:230397136-230397158 GAGCATGCAGGCGCGTGTGCGGG - Intronic
923689039 1:236175490-236175512 GTGTGTGTACACGCGGGTTCTGG + Intronic
923783230 1:237043297-237043319 GTGTGCGCGCGCGCGGGTGGTGG + Intronic
924598055 1:245464455-245464477 ATGTGTGCGTGCGCGTGTGGGGG + Intronic
1062794875 10:337204-337226 GTGTGTGCAAGTGTGTGTGGTGG + Intronic
1062802846 10:392891-392913 GTGTGTGCGCGCCTGTGTGTGGG - Intronic
1062942718 10:1436152-1436174 GTGTGTGCATGCTTGTGTGTGGG + Intronic
1062960692 10:1571664-1571686 GAGTGTGCAGGTGAGTGTGCAGG + Intronic
1062960731 10:1571961-1571983 GAGTGTGCAGGTGAGTGTGCTGG + Intronic
1062960754 10:1572153-1572175 GAGTGTGCAGGTGAGTGTGCAGG + Intronic
1063145615 10:3292714-3292736 GTGTGTGCACGTTCTTGTGCTGG + Intergenic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1064120673 10:12615438-12615460 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1064306826 10:14174913-14174935 GTGTGTGGACGCGCGCGTACGGG + Intronic
1065667356 10:28076526-28076548 GTGTGTGCGCGCATGTGTGTGGG - Intronic
1065962318 10:30743716-30743738 CTGTGTGCATGCATGTGTGCTGG - Intergenic
1066022875 10:31319936-31319958 GTTTGTGCGCGCGTGTGCGCGGG + Intronic
1066500210 10:35986095-35986117 GTGTGTGTGCGTGTGTGTGCAGG + Intergenic
1066628102 10:37430381-37430403 GTGTGTGCATGCGTGTGTGCAGG + Intergenic
1067064386 10:43095503-43095525 GTGTGTGCACGCGCACATGTGGG + Intronic
1067382947 10:45792010-45792032 GTGTATGTATGTGCGTGTGCAGG - Intronic
1067560210 10:47300154-47300176 GTGTGCGCCCGCGAGTGTGGGGG - Intergenic
1067650713 10:48152947-48152969 GTGTGTGTGCGCGCGCGTGTGGG - Intergenic
1068451700 10:57197684-57197706 GTGTGTGTATGTGTGTGTGCTGG - Intergenic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1068950132 10:62768489-62768511 GTGTGTGTGCGTGCGTGCGCTGG - Intergenic
1069867723 10:71514041-71514063 GTGTGTGCATGGGTGTGTGTGGG - Intronic
1069889355 10:71643635-71643657 GAGTGTGCACACATGTGTGCTGG - Intronic
1069919261 10:71806533-71806555 GTGTGTGTATGTGTGTGTGCAGG - Intronic
1070610659 10:77930106-77930128 GTGTGTGAGTGCGTGTGTGCAGG - Intergenic
1070637202 10:78139251-78139273 GTGTGTGTGTGTGCGTGTGCAGG + Intergenic
1071484128 10:86086680-86086702 GTGTGTGCATGGGCATGTGCAGG + Intronic
1071513865 10:86284269-86284291 GTGTGTGCAAGTGTGTGTGATGG - Intronic
1071649143 10:87378717-87378739 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
1072492961 10:95926868-95926890 GTGTGTGCGCGCGCCTGAACAGG + Intronic
1072816167 10:98511606-98511628 GTGTGTGCGCACGTGTGTGTTGG + Intronic
1073037294 10:100572960-100572982 GTGTGTGCACACGCATGGGGGGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073081798 10:100865193-100865215 GTGTGTGTAAGTGTGTGTGCAGG + Intergenic
1073082670 10:100869728-100869750 GTGTGTGCATGCATGTGTGTAGG + Intergenic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1073511889 10:104047644-104047666 GTGTGTGCGTGTGCATGTGCAGG - Intronic
1074221950 10:111446623-111446645 GTATGTGCAGACGTGTGTGCAGG - Intergenic
1075632346 10:124008330-124008352 GTGTGTGTACGCGCACGTGTGGG - Exonic
1075654870 10:124154554-124154576 GTGTGGGCATGCGTGTGTGGGGG - Intergenic
1075831530 10:125416069-125416091 GTGTGTGCACACGTGTGTATGGG - Intergenic
1076244502 10:128935978-128936000 GTGTGTGCACGTGCCTCTGCAGG - Intergenic
1076605628 10:131687596-131687618 GAGTGTGCACCTGTGTGTGCTGG - Intergenic
1076778876 10:132713212-132713234 GGGTGTGCACACGTGTGTGTAGG + Intronic
1076865786 10:133165663-133165685 ATGTGTGCGCCTGCGTGTGCAGG + Intronic
1076885061 10:133258407-133258429 GTGTGTGCATGAGCCTGTGGGGG + Intergenic
1077218953 11:1406850-1406872 GTGTGTGCATGTCCATGTGCAGG + Intronic
1077223777 11:1429016-1429038 GTGTGTACACGGGTGTGTCCTGG + Intronic
1077236797 11:1485782-1485804 GTGTGTGCAGGGGCGTGTGTGGG - Intronic
1077253145 11:1569475-1569497 ATATGTGCACACGCGTGGGCTGG + Intronic
1077281025 11:1745821-1745843 GTGTGTGCACGGGTGTGTGAGGG - Intronic
1077281032 11:1745924-1745946 GTGTGTGCACAAGTGTGTGTGGG - Intronic
1077281047 11:1746216-1746238 GTGTGTGCACAAGTGTGTGAGGG - Intronic
1077305580 11:1867350-1867372 GTGTGTGCATGTGTGTGTGTGGG - Intronic
1077358974 11:2131432-2131454 GTGTGCGCATGTGTGTGTGCAGG + Intronic
1077383177 11:2256995-2257017 GTGTGTGCATGCATATGTGCAGG + Intergenic
1078065928 11:8079652-8079674 GTGTGTGCATGCATGTGTGTAGG + Intronic
1078653110 11:13214236-13214258 GTGTGTGCACATGCTTGTGTTGG - Intergenic
1078930248 11:15906883-15906905 GTGTGTACACGCTTGTGTGTAGG - Intergenic
1078935312 11:15944188-15944210 GTGTGTGTTTGCGTGTGTGCAGG - Intergenic
1079076216 11:17386879-17386901 GTGTGTACACACGCGTGTGGGGG + Exonic
1079133584 11:17763454-17763476 GAGTGTGCATGTGCGTGTCCGGG - Intronic
1079923989 11:26469328-26469350 GTGTGTGCAGGCGCATGTGAGGG + Intronic
1080678676 11:34452539-34452561 GTGTGTGCGTGCGCGCATGCGGG + Intronic
1080779763 11:35419394-35419416 GAGCGTGCGTGCGCGTGTGCGGG + Intronic
1081310850 11:41570052-41570074 GTGTGTGTGTGTGCGTGTGCTGG + Intergenic
1081707259 11:45190118-45190140 GTGTGTGCACGTGTGTGTGTAGG - Intronic
1081837305 11:46166471-46166493 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1083766547 11:64844232-64844254 AGGTGTGCAGGCGAGTGTGCGGG + Intronic
1084009944 11:66342029-66342051 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1084285103 11:68125903-68125925 GTGTGTGCGCGCGCGCGTTATGG - Intergenic
1084470862 11:69358248-69358270 GTGTGTGCATGTGCAGGTGCAGG + Intronic
1084523479 11:69680849-69680871 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1084870084 11:72092671-72092693 GTGCGTGCAAGCACTTGTGCAGG + Intronic
1085972540 11:81611120-81611142 GTGTGTGCATGTGTGTGTGTAGG + Intergenic
1086539116 11:87886329-87886351 GTGTGTGCATGCACATGTGCAGG + Intergenic
1086980937 11:93197533-93197555 GTGTTTGCGCGCGCGCGTGTGGG - Intronic
1087161827 11:94956425-94956447 GTGTGTGTGTGCGCGTGTGATGG + Intergenic
1088566747 11:111180604-111180626 GTGTGCGCGCACGCGTGTGGTGG - Intergenic
1088901257 11:114119378-114119400 GTGTGTGCACATGTGTGTACAGG + Intronic
1088914743 11:114219036-114219058 GCGTGTGCACGCCCATGTGCTGG + Intronic
1089257109 11:117199837-117199859 GTGTGTGAACGCACCTGTGTTGG + Intronic
1089281940 11:117380877-117380899 GTGTGTGCACGTGTGTGTACTGG + Intronic
1089500028 11:118926242-118926264 GTGTGCGCGCGCGTGTGTCCAGG - Intronic
1089584500 11:119501941-119501963 GTGTGTGAACGCGTGTGTGTGGG - Intergenic
1089880235 11:121766381-121766403 AACAGTGCACGCGCGTGTGCTGG - Intergenic
1090187371 11:124747148-124747170 GTGTGTGCATGTGACTGTGCTGG + Exonic
1090285460 11:125495761-125495783 GCGTGTGTGCGCGCGTGTGAAGG - Intronic
1090553048 11:127843599-127843621 GTGTGTGCATGCCTGTGTGTGGG - Intergenic
1091023852 11:132124617-132124639 GTGTGTGCGCGCGCACGCGCAGG + Intronic
1091301879 11:134513198-134513220 GTGTGTGCGGGTGTGTGTGCAGG - Intergenic
1091334344 11:134755102-134755124 GTGTGTGCATGCTGGGGTGCAGG + Intergenic
1091594919 12:1871541-1871563 GCGTGTGTACACGTGTGTGCTGG + Intronic
1091710856 12:2739274-2739296 ATGTGTGTATGCGTGTGTGCAGG + Intergenic
1092045805 12:5431374-5431396 GTGTGCGCGCGCGTGTTTGCGGG - Intergenic
1092255326 12:6923972-6923994 GTGTGTGCACGCGCATTTTGGGG + Intergenic
1092299743 12:7235551-7235573 GTGTGTGCACACGTGTGTGTTGG - Intergenic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092677642 12:10940203-10940225 GTGTGTGCGCGCATGTTTGCTGG - Intronic
1092926770 12:13278841-13278863 GGGAGTGCCCACGCGTGTGCAGG - Intergenic
1093108366 12:15117662-15117684 GTGTGTGTGCGCGTGTGTGATGG - Intronic
1093159694 12:15731851-15731873 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1095438640 12:42219619-42219641 GTGTGTGCATGTGTGTGTGCAGG - Intronic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1097232434 12:57520834-57520856 GTGTCTGCACGCGCACGCGCAGG + Intronic
1097708357 12:62891918-62891940 GTGTGTGCATGTGTATGTGCAGG + Intronic
1097764730 12:63512528-63512550 GTGTGTGTGTGCGTGTGTGCAGG + Intergenic
1099026445 12:77469965-77469987 GTGTGTGCAGGGGCGGGTGGGGG + Intergenic
1099247275 12:80208058-80208080 GTGTGTACATGTGTGTGTGCTGG + Intergenic
1100719226 12:97339663-97339685 GTGTGTGCACGCACGTGTGCAGG + Intergenic
1102012050 12:109624713-109624735 GTGTGTGTATGTGCGTGTGCAGG + Intergenic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1102902031 12:116646422-116646444 GTGTGTGCACGTGTATGTGTGGG - Intergenic
1103237974 12:119389773-119389795 GTGTGTGCATGCCTGTGTGTTGG - Intronic
1103291671 12:119851278-119851300 GTGAGTGCACGCACATGTGTAGG + Intronic
1103505859 12:121442171-121442193 GTGTGTGCATGCGGGTCTGCAGG - Exonic
1103744859 12:123115538-123115560 GTGTGTGCGTGTGTGTGTGCGGG - Intronic
1103907213 12:124333858-124333880 GTGTGTGTGCGCATGTGTGCGGG + Intronic
1103907215 12:124333892-124333914 GTGTGCGCGCGCATGTGTGCGGG + Intronic
1103919478 12:124392044-124392066 GTGTGTACACACGCGTGTGGAGG + Intronic
1103971734 12:124676888-124676910 GTGTGTGTGCGTGCGTGCGCGGG + Intergenic
1104000373 12:124856395-124856417 GTGTTTGCACACACGTGTGTTGG - Intronic
1104424509 12:128664115-128664137 GTGAGTGCCCGCGTGCGTGCGGG - Intronic
1104759893 12:131290804-131290826 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
1104759894 12:131290816-131290838 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
1104759895 12:131290828-131290850 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
1104820829 12:131676332-131676354 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1104820830 12:131676344-131676366 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1104820832 12:131676366-131676388 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1104903328 12:132200939-132200961 GTGAATGCACACGTGTGTGCAGG + Intronic
1104944942 12:132411378-132411400 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1104944969 12:132411589-132411611 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1104980532 12:132571431-132571453 GTGTGTGTTGGTGCGTGTGCTGG - Exonic
1105601262 13:21889993-21890015 GTGTGTGTGTGCGCGTGTGTAGG + Intergenic
1105638179 13:22236370-22236392 GTGTGTGTATGCATGTGTGCAGG + Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1106486070 13:30173881-30173903 GTGTGTGCACATGTGTGTGGGGG - Intergenic
1107625572 13:42279242-42279264 GGGTGTGCACGTGCGTGCACTGG - Intronic
1108146698 13:47484691-47484713 GTGTGTGCATGCGCATGTGCAGG - Intergenic
1109760535 13:66822123-66822145 GTGTGTGTGCGCGTGTGTGATGG - Intronic
1110408615 13:75179109-75179131 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1111265073 13:85799692-85799714 GTGTTTGCACACATGTGTGCAGG + Intergenic
1111343437 13:86917682-86917704 GTGTGTGCGCGCGCACGTGGTGG - Intergenic
1111950251 13:94704034-94704056 ATGTGTGCGCGCGCGCGTGAAGG + Intergenic
1112439329 13:99414440-99414462 GTGTGTGCACGTGTGTGAGTGGG - Intergenic
1112944826 13:104915358-104915380 GTGTGTGCAGGTGCGTGTGTGGG - Intergenic
1112944828 13:104915370-104915392 GTGTGTGCATGTGTGTGTGCAGG - Intergenic
1113349672 13:109516790-109516812 GTGTGTGCGCGCACATGTGCAGG + Intergenic
1113734231 13:112665839-112665861 GTGTGTCCATGTGAGTGTGCGGG + Intronic
1113766589 13:112885024-112885046 TTGTGTGCATGCATGTGTGCAGG - Exonic
1113870567 13:113557260-113557282 GTGTGTGCACAGGTGTGTCCAGG + Intergenic
1113874131 13:113584238-113584260 GTGTGTGCACGTGGGGGAGCAGG - Intergenic
1113874139 13:113584280-113584302 GTGTGTGCACGTGGGGGAGCGGG - Intergenic
1113909467 13:113835326-113835348 GTGTGTGCTCACGTGTGTGCGGG + Intronic
1113962063 13:114131817-114131839 GTGTGTGCGCGTGCGTTTGTGGG - Intronic
1113963943 13:114141306-114141328 GTGTGTGCATGTGTGTGTGAGGG - Intergenic
1113964002 13:114141962-114141984 GTGTGTGCATGTGGGTGTGAGGG - Intergenic
1114495161 14:23127087-23127109 GTGTGTGTACTCGCATGTGTTGG + Exonic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1115413290 14:33101134-33101156 GTGTGTGCAGGTGTGTGTGGGGG - Intronic
1116530354 14:45965255-45965277 GTGTGTGCGCGTGTGTGTGCTGG + Intergenic
1117252984 14:53953904-53953926 GTGTGTACACGCGCGTGGGCAGG - Intronic
1118222556 14:63868732-63868754 GTGTGTGTATGTGTGTGTGCTGG + Intronic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1118693682 14:68363745-68363767 GTGTGTGCACACGCGTGTGTGGG + Intronic
1118917048 14:70116359-70116381 GTGTGTGCACGTTTGTGTGCAGG + Intronic
1119695932 14:76713477-76713499 GTGTGTGCACGGATGTGTGCTGG - Intergenic
1120334533 14:83137498-83137520 GTGTGTGCTCACACATGTGCAGG + Intergenic
1120881059 14:89416120-89416142 GCGTGCGCGCGCGCGCGTGCTGG - Intronic
1121120884 14:91375267-91375289 GTGTGTGCGCGCGCGCATGTGGG + Intronic
1121421260 14:93816905-93816927 GTGTGTGTATGTGTGTGTGCAGG - Intergenic
1122120596 14:99551551-99551573 GAGTGTGCAGGTGGGTGTGCAGG + Intronic
1122544375 14:102514127-102514149 GTGTGTGCATGCGTGTGCGTGGG + Intergenic
1122792408 14:104189828-104189850 CCGTGTGCATGCGTGTGTGCGGG - Intergenic
1122888426 14:104721894-104721916 GTGGCTGCACGCGTGTATGCAGG + Intronic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1124491674 15:30161731-30161753 GTGTGTGCGTGTGCGTGTGTTGG + Intergenic
1124631686 15:31341350-31341372 GTGTGTGTACGTGTGTGTGTCGG + Intronic
1125333482 15:38604853-38604875 GTGTGTGCGTGCGTGTGTGTCGG + Intergenic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1125486271 15:40113045-40113067 GTGTGTGTATGCGTGTGTGCGGG + Intergenic
1125917604 15:43503153-43503175 GTGTGTGTGCGCGCATGCGCGGG + Intronic
1126057666 15:44746735-44746757 GTGTGTGCACGTGCACGTGCTGG - Intronic
1126393923 15:48191615-48191637 GTGTGCGCGCGCGCGTTTGCAGG - Exonic
1126415552 15:48414398-48414420 GTGTGTGTACACGCATGTGGAGG + Intronic
1128580874 15:68808759-68808781 GTGTATGCATGTGCGTGTGCAGG - Intronic
1128789089 15:70419488-70419510 GTGTGTGCATGCGGGTCTGAGGG - Intergenic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129460150 15:75696506-75696528 GTGTGTGTGTGCGCGTGTGTGGG + Intronic
1129460151 15:75696510-75696532 GTGTGTGCGCGTGTGTGGGCCGG + Intronic
1129741243 15:77990656-77990678 GTGTGTGCGCGCGCATGTTGGGG - Intronic
1130369204 15:83269439-83269461 GTGTGTGCGCGCGCATCTGGAGG + Intronic
1130550399 15:84886869-84886891 GTGTGTGCACGCACATGCACGGG + Intronic
1131713750 15:95085567-95085589 GTGTGTGTGTGCGCGTGCGCAGG + Intergenic
1132353339 15:101154264-101154286 GTGGGTGCAAGTGTGTGTGCAGG - Intergenic
1132464977 16:73160-73182 ATGTGAGCACGTGCATGTGCAGG - Intronic
1132505456 16:306132-306154 GTGTGTGCCTGCGCATGTGTGGG - Intronic
1132649271 16:1013161-1013183 GGGTGTGCACGCATGTGTCCTGG - Intergenic
1132649281 16:1013241-1013263 ATGTGTGCACTCGTGTGTCCTGG - Intergenic
1132649285 16:1013283-1013305 GGGTGTGCACTCGTGTGTCCTGG - Intergenic
1132976074 16:2711791-2711813 GTGTGTGCACGGGTGCGTGTGGG + Intergenic
1133272146 16:4615431-4615453 ATGTGTGCAGGCGCCTGAGCTGG + Intergenic
1133924261 16:10181172-10181194 GTGTGTGCACGCGCGCGTGTAGG - Intronic
1134203658 16:12219915-12219937 GTGTGTACACGTGTGTGCGCTGG - Intronic
1135656415 16:24254374-24254396 GTGTATGCATGCACGTGTGTAGG - Intergenic
1135656687 16:24256284-24256306 GTGTGTGCGAGCGCGTGTGCTGG - Exonic
1136052775 16:27664864-27664886 GTGTGTGCATGTGCATGTGTAGG + Intronic
1136399828 16:30011215-30011237 GTGTGCACACGAGTGTGTGCCGG - Intronic
1136537891 16:30911046-30911068 CTGTGTGCACGCGTGTGTCTGGG - Intergenic
1136690410 16:32024496-32024518 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1136790999 16:32968060-32968082 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1136878814 16:33885872-33885894 GTGTGTGCACGTATGTGTGCTGG + Intergenic
1137731375 16:50693230-50693252 GTGTGTGTGCGCGTGTGTGCTGG + Intergenic
1137788570 16:51155519-51155541 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1137793570 16:51195914-51195936 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1138149121 16:54638622-54638644 GTGTGTACGCGTGTGTGTGCTGG - Intergenic
1138431808 16:56973564-56973586 GTGTGTGCACACGCATGGGGAGG + Intronic
1138561419 16:57802772-57802794 GTGTGTGCCAGCCCGTGTGCAGG - Intronic
1138654202 16:58481460-58481482 GTGTGTGTGCGCGCGCATGCAGG + Intronic
1138726328 16:59143571-59143593 GTGTGTGTAGGTGTGTGTGCTGG - Intergenic
1139199423 16:64957585-64957607 GTGTGTGCACGGGCATGTGTGGG - Intronic
1140529883 16:75655976-75655998 GTGTGTGCACGTGTGTGTGAGGG - Intronic
1141304749 16:82851695-82851717 GTGTGTGCATGCACATGTCCTGG + Intronic
1141520944 16:84579084-84579106 GTGTGTGCATGCCTGTGTGTGGG - Intronic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1141990212 16:87604985-87605007 GTGTGTGTGCGCGCGCGTGCAGG + Intronic
1203093206 16_KI270728v1_random:1229517-1229539 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1142561604 17:812573-812595 GTGTGTGCACGTGTGTGTGATGG + Intronic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1143109810 17:4546712-4546734 GTGTGCGCATGTGCGTGTGCAGG + Intronic
1143300091 17:5902555-5902577 GTGCGTGCAGGGCCGTGTGCAGG - Intronic
1143535057 17:7533423-7533445 GTGTGTGCGTGTGTGTGTGCAGG + Intergenic
1144269310 17:13601566-13601588 GTGAGGGCACGCGCGGCTGCCGG + Exonic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1144976426 17:19141553-19141575 GTGTGTGCGCTTGTGTGTGCTGG + Intronic
1145390291 17:22450554-22450576 GTGTGTGCACATGTGTGGGCCGG - Intergenic
1146008831 17:29178908-29178930 GTGTATGCACTGGGGTGTGCTGG - Intronic
1146233039 17:31130748-31130770 GTGCTTGCACGCATGTGTGCTGG + Intronic
1146669939 17:34730241-34730263 GTGTGTGCATGTGTGTGTGCGGG - Intergenic
1146913307 17:36661759-36661781 GTGTGTGCCCACGCTTATGCAGG - Intergenic
1146972048 17:37081338-37081360 GTGTATGCACGCGCGCGTGGGGG + Intergenic
1147139487 17:38453453-38453475 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1147153267 17:38530631-38530653 GTGTGTGCAGGTATGTGTGCTGG - Exonic
1147168671 17:38605947-38605969 GTGTCTGCGCGCGCGCGGGCCGG + Intergenic
1147241539 17:39093931-39093953 GGGTGTGCACATGCGTGTGCGGG - Intronic
1147585525 17:41652134-41652156 GTGTGTGCATGCGTGTGTGTTGG - Intergenic
1147585528 17:41652191-41652213 GTGTGTGCATGCATGTGTGTTGG - Intergenic
1148210154 17:45803790-45803812 GTGTGTGCATGTGTGTGTGTTGG + Intronic
1148563406 17:48619262-48619284 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
1149614581 17:57987821-57987843 GTGTGTGTGCGTGTGTGTGCTGG + Intronic
1149992685 17:61391644-61391666 GTGTGTGCAGGCGTGGGTACGGG + Intronic
1150498527 17:65628116-65628138 GTGCGTGCACGCGAGAGTGATGG - Intronic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151414686 17:73953398-73953420 GTGTGTGTGAGCGCGTGTGAGGG - Intergenic
1151828729 17:76537710-76537732 GTGTGTGCGTGCGTGTGTGCAGG + Exonic
1152191877 17:78893069-78893091 GAGTGTGTGCACGCGTGTGCAGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152271972 17:79330101-79330123 GTGTGAGCATGTGTGTGTGCAGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152466689 17:80470677-80470699 CTGTGTGCGTGTGCGTGTGCAGG + Exonic
1152575439 17:81138398-81138420 GTATGTGCACGCACGTGTGGGGG - Intronic
1152582009 17:81169978-81170000 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1152698505 17:81807726-81807748 GTGGGTCCACGTGCATGTGCGGG - Intronic
1152733417 17:81984828-81984850 GTGTGTGCAGGGGTGTGTGGGGG - Intronic
1152733427 17:81984861-81984883 GTGTGTGTGCGGGGGTGTGCAGG - Intronic
1152733454 17:81984975-81984997 GGGTGTGCACGCAGGTGTGTGGG - Intronic
1152733495 17:81985279-81985301 GTGTGTGCATGTGAGTGTGCAGG - Intronic
1152855047 17:82660338-82660360 GTGTGTGTACACGTGCGTGCAGG - Intronic
1152855055 17:82660541-82660563 GTGTGTGTACACGTGTGTGTAGG - Intronic
1152855059 17:82660610-82660632 GTGTGTGTGCACGTGTGTGCAGG - Intronic
1152855061 17:82660673-82660695 GTGTGTGTACATGTGTGTGCAGG - Intronic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1153596347 18:6729307-6729329 GTGCGTGCGCGCGCATGTGTCGG - Intergenic
1153947992 18:10033482-10033504 GTGTGTGCACCTGCATGTGTGGG + Intergenic
1154285388 18:13051371-13051393 GTGTGTGTGTGCGTGTGTGCGGG + Intronic
1154300824 18:13190926-13190948 GTGTGTGTGTGCGTGTGTGCGGG + Intergenic
1154379064 18:13833392-13833414 TTGTGTGCACACGTGTGTGTTGG + Intergenic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1155618736 18:27751310-27751332 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1156008384 18:32470234-32470256 GCGGGTGTGCGCGCGTGTGCTGG - Intronic
1156687494 18:39667697-39667719 GTGTGTGTGTGCGTGTGTGCAGG - Intergenic
1157113759 18:44844326-44844348 GTGTGTGCACGTGTGTGTGTGGG - Intronic
1157263888 18:46200084-46200106 GTGTGTGTGCGCGCGCGTGCTGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1157605033 18:48920991-48921013 CTGTGTGTGCACGCGTGTGCAGG - Exonic
1157625378 18:49046288-49046310 GTGTGTGCGCGCGCATGTCTGGG - Intronic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158379901 18:56917545-56917567 GTGTGTGCATGCATGTGTGTGGG + Intronic
1158400924 18:57121187-57121209 GTGTGTGCACGCGAGTGCGCAGG + Intergenic
1158427474 18:57352713-57352735 GTGAGCGCGCGCGCGTGTGGCGG - Exonic
1159991668 18:74915780-74915802 GTGTGTGTACATGTGTGTGCTGG + Intronic
1159991705 18:74916214-74916236 GTGTGTGTACATGTGTGTGCTGG + Intronic
1160024778 18:75208750-75208772 GTGTGGGCACGCGGGCGGGCTGG + Intronic
1160513763 18:79467183-79467205 GCGTGTCCACACGCGTGTGCAGG + Intronic
1160557748 18:79736949-79736971 ATGTGTGCACAGGCGTGTGCAGG + Intronic
1160588185 18:79924370-79924392 GTCTGTGCGCTCGCCTGTGCTGG - Intronic
1160623264 18:80185827-80185849 GTGGGTGCATGCGTGTGTGAGGG - Intronic
1160780829 19:877282-877304 GTGCGCGCACGCCCGTGTGTGGG + Intronic
1160962404 19:1729084-1729106 GTGTGTGCATGCGTGTGAGAGGG + Intergenic
1160962424 19:1729306-1729328 GTATGTGCATGTGTGTGTGCAGG + Intergenic
1161170358 19:2809639-2809661 GGATGTGCACACGCGTGTGCTGG - Intronic
1161322777 19:3648967-3648989 GTGTGTGCATGTGTGTGTCCAGG - Intronic
1161643068 19:5436358-5436380 GTGTGCGCGCGCGCGCGTGCGGG + Intergenic
1161725468 19:5925869-5925891 GTGTGTGCGCGTGCATGTGCTGG + Intronic
1162015291 19:7842902-7842924 GTGTGTGCATGTGTGTGTGAAGG + Intronic
1162129532 19:8517564-8517586 GTGTGTGTGTGCGTGTGTGCAGG + Intergenic
1162301531 19:9847698-9847720 GTGTGTGCATGTGTGTGTGCTGG + Intronic
1162558017 19:11399817-11399839 GTGTGTGCATGCGGGCCTGCGGG - Intronic
1163369253 19:16892888-16892910 GTGTGTGCATGTGTGTGTCCCGG - Intergenic
1163380087 19:16960310-16960332 GTGTTTGCACACACGTCTGCGGG - Intronic
1164479689 19:28601945-28601967 GTGTGTGCATGTGCGTGTGTGGG - Intergenic
1164574136 19:29395818-29395840 GTGTGTGCACTTGCCTGTGTGGG - Intergenic
1165264141 19:34646418-34646440 GTGTATGCATGTGCCTGTGCAGG - Intronic
1165395270 19:35560418-35560440 GTGCGTGCACTCGGGTGAGCGGG + Exonic
1165531903 19:36409978-36410000 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
1165716190 19:38047223-38047245 GTGTGTGCGTGCGTGTGTGTCGG - Intronic
1166780787 19:45341575-45341597 GTGTGCGCGCGCGCGTGTGGTGG + Intronic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1167254905 19:48421596-48421618 GTGTCTGCAACCGTGTGTGCTGG + Intronic
1168145400 19:54417227-54417249 GTGTGTGCATGTGAGTGTGTTGG - Intronic
1168474196 19:56664295-56664317 CCGTGTGCACGCGCCGGTGCTGG + Exonic
1168474240 19:56664547-56664569 CCGTGTGCACGCGCCGGTGCTGG + Exonic
924991805 2:318909-318931 GTGTGTGCGGGCACGTGTGCAGG + Intergenic
924991807 2:318933-318955 GTGCGTGCAGGCGTGTGTGCAGG + Intergenic
924991816 2:318996-319018 GTGTGTGCGGGCGTGTGTGTGGG + Intergenic
924991846 2:319239-319261 GTGTGTGGACACGTGTGTGTGGG + Intergenic
924991868 2:319375-319397 GTGTGTGCGTGGGTGTGTGCAGG + Intergenic
924991869 2:319387-319409 GTGTGTGCAGGCGTGTGTGCAGG + Intergenic
924991878 2:319433-319455 GTGTGTGCGCGGGTGTGTGCAGG + Intergenic
924991880 2:319445-319467 GTGTGTGCAGGCGTGTGTGCGGG + Intergenic
924991883 2:319473-319495 GTGTGTGTGGGCGTGTGTGCAGG + Intergenic
925126633 2:1461756-1461778 GTGTGTGCAGGTGTGTGTGTGGG - Intronic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
925691567 2:6529378-6529400 GTGTGCACATGCGCATGTGCTGG + Intergenic
925749718 2:7076976-7076998 GTGTGTGCCAGCCCCTGTGCTGG + Intergenic
925872451 2:8282963-8282985 GTGCGTGCATGTGAGTGTGCAGG - Intergenic
925974343 2:9130775-9130797 ATGTGTGCATGCGTGTGTGTGGG + Intergenic
926122495 2:10252429-10252451 GTGTGTGCATGTGCGTGTGGTGG + Intergenic
926140991 2:10368189-10368211 GTGTGTGCATACGTGTGTGTAGG + Intronic
926140995 2:10368270-10368292 GTGTGTGCATACGTGTGTGTAGG + Intronic
926285374 2:11483201-11483223 GTGTGGGCGCGCGTGTGTGTGGG + Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927018172 2:18989776-18989798 GTGTGTGTGCGTGTGTGTGCAGG + Intergenic
927235518 2:20870908-20870930 GTGTGTGCGCGCGCGCATTCAGG + Intergenic
928171307 2:29005288-29005310 GTGTGTGCATGTGTGTGTGTGGG + Intronic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929360185 2:41078797-41078819 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
929667815 2:43846975-43846997 GTGTGTGCACGCGCGCGTGCAGG - Intronic
930003444 2:46877553-46877575 GTTTGTGCACGCGCGTGTCTGGG - Intergenic
930872629 2:56184207-56184229 GTGCGTGCACGCCTGTGTGCAGG + Exonic
931184120 2:59933157-59933179 GTGTGTGCATATGTGTGTGCAGG - Intergenic
931694214 2:64859844-64859866 GTTTGTGCTCGCGCGCCTGCAGG + Intergenic
931796085 2:65711542-65711564 GGGTGTGCACATGGGTGTGCTGG + Intergenic
931972845 2:67609037-67609059 GTGTGTGTACGTGGGTGTGTGGG - Intergenic
932453142 2:71828568-71828590 GTGTGTGCGTGTGTGTGTGCAGG - Intergenic
933817235 2:86077796-86077818 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
934987919 2:98900611-98900633 GCGTGTGCATGCGTGCGTGCAGG + Intronic
935408573 2:102735829-102735851 GTGTGCGCGCGCGCGTGTCCTGG - Intronic
936964079 2:118109601-118109623 ATGTGTGCACACGTGTGTGTTGG + Exonic
937265690 2:120613499-120613521 GTGTGCACGCACGCGTGTGCTGG - Intergenic
937288849 2:120769886-120769908 GTGTGTGCATGTGCATGTGTGGG + Intronic
937512225 2:122608954-122608976 GTGTGTGCATGTGTGTGTGTAGG - Intergenic
937950856 2:127387383-127387405 GTGTGTGCGCGCGTGTGTGTCGG - Intronic
937986842 2:127641841-127641863 GTGTGTGCACTCGGGTCTCCTGG + Intronic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
939075702 2:137600092-137600114 GTGTGTGCATGCATGTGTGCAGG - Intronic
939567972 2:143807062-143807084 GTATGTGCAGCCGCGTGTGGTGG - Intergenic
939713338 2:145551634-145551656 GTGTGTGGATGTGCGTGTGCAGG + Intergenic
942425128 2:175852091-175852113 GGGTGTGTATGCGCGTGTGTAGG - Intergenic
945033359 2:205684939-205684961 GTGTGTGCGCGCTCGCGCGCTGG - Intronic
945699440 2:213151853-213151875 GTGTGCGCGCGCGCGCGGGCTGG + Intronic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
947693133 2:232158329-232158351 GTGTGTGCATGTGTGTGTTCGGG + Intronic
947744946 2:232502638-232502660 GTGTGCGCACGCGTGTGTGCAGG + Intergenic
948460045 2:238124759-238124781 GAGTGTACATGCGTGTGTGCAGG + Intronic
948556739 2:238816996-238817018 ATGTGTGCACGTGCGTGTGACGG + Intergenic
948737003 2:240015689-240015711 GGGTGTGCATGAGCATGTGCAGG - Intronic
948772253 2:240257623-240257645 GTGTGTGTGCACGCGTGTGGAGG - Intergenic
1169832240 20:9838174-9838196 GTGTGTGCGCGCGCGCCTGGTGG - Intronic
1170045629 20:12082423-12082445 GTGTGTGCACGTGTGTGTCTGGG - Intergenic
1170180788 20:13527601-13527623 GTGCGTGCGTGCGTGTGTGCAGG - Intronic
1170548669 20:17456614-17456636 GTATGCACACGCACGTGTGCTGG - Intronic
1170933238 20:20787825-20787847 GTGTGTGCACGCCTGTGTGTGGG - Intergenic
1171174063 20:23038058-23038080 GTGTGTGCATGTGTGTTTGCAGG - Intergenic
1171294185 20:24003150-24003172 GTGTTTGCACATGCGTGTGTGGG - Intergenic
1171295593 20:24014199-24014221 GTGTGTGTATGTGTGTGTGCAGG + Intergenic
1172587245 20:36093370-36093392 GTGTGTGCGCGTGTGAGTGCGGG + Intronic
1173028669 20:39333925-39333947 GTGTGTGCATGTGTGTGTGCAGG - Intergenic
1173054322 20:39596761-39596783 GTGTGTGCACACGTGTGTGTGGG + Intergenic
1173418991 20:42883919-42883941 GTGTGTGCATGCCTGTGTACTGG - Intronic
1174179881 20:48668159-48668181 GTGCGTGCATGCGCATGTGCAGG + Intronic
1174968884 20:55251375-55251397 GTGCGTGCATGTGCGTGTGTGGG - Intergenic
1175073371 20:56353495-56353517 GTGTGTGCATGCATGTGTGCGGG - Intergenic
1175314938 20:58040545-58040567 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1175417890 20:58813449-58813471 GTGTGTGCGCGCGCGCATGTGGG - Intergenic
1175541621 20:59751453-59751475 GTGCATACATGCGCGTGTGCAGG - Intronic
1175778503 20:61667661-61667683 GAGTGTGCATGCACGTGTGCAGG - Intronic
1175850421 20:62087942-62087964 GCGTGTGCAGGTGAGTGTGCAGG - Intergenic
1175850437 20:62088186-62088208 GTGTGTGCAGGTGAGTGTACAGG - Intergenic
1175875816 20:62228776-62228798 GTGTGTGCACGTGCGTCTGTGGG + Intergenic
1175899506 20:62354474-62354496 GTGTGTGCACCCCCAGGTGCAGG - Intronic
1176106031 20:63387540-63387562 GGGCATGCACGTGCGTGTGCGGG - Intergenic
1176110661 20:63409313-63409335 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1176176879 20:63732179-63732201 GTGTGTGCATGTGTGGGTGCGGG + Intronic
1176176902 20:63732370-63732392 GTGTGTGCGCGCATGTGTGTGGG + Intronic
1176185933 20:63779050-63779072 GTGTGCTCACGAGCGTGTTCAGG + Intronic
1176245800 20:64095938-64095960 GTGTGTGTACATGTGTGTGCAGG + Intronic
1176302792 21:5106697-5106719 GTGTGTATCCGTGCGTGTGCAGG - Intergenic
1177756345 21:25352834-25352856 GTGTGTGCATGCATGTGTGAAGG - Intergenic
1178407509 21:32336642-32336664 GTGTGTGCATGCGTGTATGTAGG - Intronic
1178928759 21:36798202-36798224 GTGTGTGTATGTGTGTGTGCAGG + Intronic
1178992462 21:37367109-37367131 GATTGTGCGCGCGAGTGTGCGGG + Intronic
1179144883 21:38759250-38759272 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1179173330 21:38989944-38989966 ATGTATGCACGTGCGTGTGCAGG + Intergenic
1179308739 21:40178255-40178277 CTGTGTGCATGTGCGTGTGTGGG + Intronic
1179359450 21:40691993-40692015 GTGTGTGCACCCGCATGTGAGGG + Intronic
1179569250 21:42268381-42268403 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1179827550 21:43975386-43975408 GTGTGTGCACTGGTGTGTGGTGG + Intronic
1179854232 21:44155226-44155248 GTGTGTATCCGTGCGTGTGCAGG + Intergenic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1180060037 21:45380131-45380153 GTGTGTGCACGGACGGATGCTGG - Intergenic
1180611535 22:17101350-17101372 GTGTGTGCACGCGTGTGTGCAGG - Intronic
1180969592 22:19808206-19808228 GTGTGTGCATGCGTTTGTGTGGG - Intronic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1181596730 22:23920123-23920145 GTGTGTGCGCGTGTGTGTGATGG + Intergenic
1182022577 22:27093720-27093742 GTGTGTGCGTGTGTGTGTGCAGG - Intergenic
1182041637 22:27242813-27242835 GTGTGTGTGCGCGCGTGCGCGGG - Intergenic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1182279803 22:29211650-29211672 GTGCGTGCATTTGCGTGTGCAGG + Intronic
1182897588 22:33871654-33871676 GTGCGTGCACGCTTATGTGCAGG - Intronic
1183034868 22:35134019-35134041 GTGTGTGTGCGCGTGTGCGCAGG + Intergenic
1183278190 22:36914564-36914586 GTGTGTGCAGGTGTGTGTACTGG + Intronic
1183358807 22:37372924-37372946 GTGTGTGCGTGCGTGCGTGCGGG + Exonic
1183369888 22:37426598-37426620 GTGTGTGTGCGTGCGTGTGTGGG - Intronic
1183420782 22:37710208-37710230 ATGTGTACACTCACGTGTGCAGG + Intronic
1184128942 22:42505721-42505743 GTGTGTGCGCGTGCGTGTGGTGG - Intergenic
1184137737 22:42559036-42559058 GTGTGTGCGCGTGCGTGTGGTGG - Intronic
1184678358 22:46055410-46055432 GTATGTGCACGTGGGTGTGCAGG + Intronic
1185203999 22:49526348-49526370 GTGTGTGCACCTGTGTGTGCAGG + Intronic
1185275052 22:49947141-49947163 GTGTGTGCCTGCGGGTGTGCCGG - Intergenic
949184568 3:1174882-1174904 GTGTGTGCACACGCGTGTGTGGG - Intronic
950544366 3:13629857-13629879 GTGTGTTCTCACACGTGTGCTGG - Exonic
950576159 3:13833358-13833380 GTGTGTGTGCGCTTGTGTGCCGG - Intronic
951729797 3:25797979-25798001 GTGTGTGTGCGCGTGTGTGTAGG - Intergenic
951996861 3:28740146-28740168 GTGTGTGTGCGTGCGTGTGTTGG - Intergenic
952971077 3:38650530-38650552 GTTTGCGCGCGCGCGTGTGTGGG - Intergenic
953284480 3:41593389-41593411 GTGTGTGCATGCATGTGTGTAGG - Intronic
953369298 3:42373547-42373569 GGGTGTGCATGTGTGTGTGCAGG + Intergenic
953914290 3:46908802-46908824 GGATGTGCACGTGTGTGTGCAGG + Intergenic
954256661 3:49412060-49412082 GTGAGTGCGCGCGCGTGCGCGGG - Exonic
954505455 3:51067451-51067473 GTGTGTGCGCGCGCGTTGGAGGG + Intronic
954721806 3:52570847-52570869 ATGTGTGCACATGCGTGTGCAGG + Intronic
955456781 3:59130293-59130315 GTGTGTGCGCGCTTGTGTTCAGG + Intergenic
956129182 3:66038454-66038476 TTGAGTGCGCGAGCGTGTGCAGG - Intronic
956456512 3:69426336-69426358 GTGTGTGCATGTGTGTGTGTTGG + Intronic
956897257 3:73675471-73675493 GTGTGTGCACCCACGCGTGGTGG + Intergenic
957673728 3:83339774-83339796 GGGTGTCCACACGCATGTGCAGG + Intergenic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
959117683 3:102196878-102196900 GTGTGTGCACATGTGTGTGATGG - Intronic
959158993 3:102700953-102700975 GTGTGTGCACATGTGTGTGATGG - Intergenic
961515520 3:127431340-127431362 GTGCGTGCACGTGTGTGTGCAGG + Intergenic
961638841 3:128352106-128352128 GTGTGTGCATGCATGTGTGATGG - Intronic
961653166 3:128427501-128427523 GTGTGTGCATGGGCGTGAGCAGG - Intergenic
962648711 3:137466482-137466504 GTGTGTGTGTGCGCGTGTGTTGG + Intergenic
963284749 3:143423202-143423224 GTGTGTGTACGTGTGTGTGAGGG - Intronic
965519425 3:169658454-169658476 GGGTGTGCACACGCATGTGTGGG + Intronic
965848681 3:172994548-172994570 GTGTGTGCACACGCACGTGATGG + Intronic
965889525 3:173494143-173494165 GTGTGTGCGCGTGCATGTGCGGG + Intronic
967118498 3:186362332-186362354 GTGTGTGTACGCGCGCGCGCCGG - Intergenic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
967778281 3:193407257-193407279 GTGTGTGCACGCATGTGTGTAGG - Intronic
968200942 3:196754736-196754758 GTGTGTCTGCGCCCGTGTGCAGG - Intronic
968433103 4:570461-570483 GTGCATGCTCACGCGTGTGCAGG - Intergenic
968434455 4:577143-577165 GTGTGCGCGCGCGTGTGTGCGGG + Intergenic
968522725 4:1041331-1041353 GTGTGTGCATGTGTGTGTGTCGG + Intergenic
968564768 4:1305719-1305741 GTGTGTGCGCACGCGTGTGTGGG + Intronic
968605913 4:1535276-1535298 GTGTGTGTGCGTGCATGTGCCGG + Intergenic
968605921 4:1535424-1535446 ATGTGTGCACGTGTGTGTGCTGG + Intergenic
968950049 4:3685956-3685978 ATGTGTGCACACGTGTGTGGGGG - Intergenic
969239368 4:5888783-5888805 GTGTGTGGCCGCGCGTCTGGAGG + Intronic
969301497 4:6299965-6299987 GTGTGTGCACGTGTGTGTACGGG + Intronic
969401138 4:6956479-6956501 GTCTGTGTAGGCGCGTGCGCAGG - Intronic
969533819 4:7743791-7743813 GTGTGTGCGCGCGCGCGTGAGGG - Intergenic
969609310 4:8218130-8218152 GTGTGTGCACGTGTGTGTGTTGG + Intronic
970050875 4:11913543-11913565 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
971403199 4:26295278-26295300 GTGTGTGCATGGGTGTGTGTGGG + Intronic
972311819 4:37890152-37890174 GTGTGTTCCTGCGCGTGTGCCGG + Intergenic
972351436 4:38239790-38239812 GAGTGTGCACACGTGTGTGAAGG + Intergenic
973878674 4:55247169-55247191 GTGTGTGTATGTGTGTGTGCAGG - Intergenic
975339142 4:73218053-73218075 GTGTATACACACGCGTATGCTGG + Intronic
975883639 4:78939509-78939531 GGGTGTGCTCGAGCGTGCGCTGG + Intergenic
976800700 4:88988227-88988249 ATGTGTGCACACCCATGTGCAGG - Intronic
976874727 4:89838176-89838198 CTGTGTGCATGTGCGTGTGGTGG - Intronic
976936815 4:90646311-90646333 GTGTGTGTATGTGTGTGTGCAGG + Intronic
977845231 4:101759876-101759898 GTGTGTGCACACGCACATGCAGG + Intronic
978073193 4:104495383-104495405 GTGTGTGTGCGTGCGTGTGCGGG + Intergenic
978384967 4:108169151-108169173 GTGTGTGCGCGCGCGCCTGGAGG + Intergenic
980113595 4:128658317-128658339 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
980249254 4:130292884-130292906 GTGTGTGCGCGTGTGTGTGTGGG + Intergenic
980925441 4:139132434-139132456 GTGTGTGCATGCACATGTGGTGG - Intronic
981034458 4:140154504-140154526 GTATGCGCGCGCGCGTGCGCGGG + Intergenic
982625653 4:157762766-157762788 GTGTGTGTATGTGTGTGTGCTGG - Intergenic
982917979 4:161238036-161238058 GTGTGTGCACTCATGTGTGCCGG + Intergenic
982961941 4:161850470-161850492 GTGTGTGCTTGTGCATGTGCAGG + Intronic
983577002 4:169270994-169271016 GTGTGTGTGCGCGCGTGAGGGGG - Exonic
985269829 4:188183643-188183665 GTGTGTGCATGCGTGTTTGATGG + Intergenic
985539076 5:479471-479493 CTGTGGGCACCTGCGTGTGCTGG + Intronic
985564851 5:610399-610421 GTGTGTGCAGAGGTGTGTGCAGG - Intergenic
985564882 5:610580-610602 GTGTGTGCAGAGGTGTGTGCAGG - Intergenic
985564918 5:610837-610859 GTGTGTGCAACAGTGTGTGCAGG - Intergenic
985564935 5:610949-610971 GTGTGTGCAACAGTGTGTGCAGG - Intergenic
985564943 5:610999-611021 GTGTGTGCAACAGTGTGTGCAGG - Intergenic
985565851 5:616824-616846 GTGTGTGTGCGCGCGAGTGGGGG + Intronic
985650102 5:1103642-1103664 GTGTGTACACGTGTATGTGCGGG - Intronic
985656896 5:1136984-1137006 GTGTGTGCACATGTGTGTCCTGG - Intergenic
985672036 5:1211822-1211844 GTGTGTGCATGTGCATGTGTGGG + Intronic
985672045 5:1212043-1212065 GTGTGTGCATGTGCATGTGTGGG + Intronic
985730525 5:1544880-1544902 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
985730556 5:1545135-1545157 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
985949446 5:3212251-3212273 GTGTGTGCACATGGGTGTACAGG + Intergenic
985963944 5:3325250-3325272 GTGTGAGCGCGCGCGTGCGTGGG + Intergenic
986282742 5:6336900-6336922 GTGTGTGTGCACGTGTGTGCTGG - Intergenic
986479072 5:8166317-8166339 GTCTGTGTATGCGCTTGTGCTGG + Intergenic
986719993 5:10554143-10554165 GTGTGTGCATGCAGGTGTGCTGG + Intergenic
986749861 5:10777249-10777271 CTGTGTGCATGCATGTGTGCAGG - Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
987300262 5:16590934-16590956 GTGTTTGCATGTGCGTGTGTGGG - Intronic
987448442 5:18051469-18051491 GTGCATGCACGCGCGTGTCTTGG + Intergenic
987872283 5:23636443-23636465 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
987901085 5:24013042-24013064 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
988563261 5:32299780-32299802 GTGTGTGCACACATGTGTGATGG - Intronic
989033993 5:37150509-37150531 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
990009316 5:50976999-50977021 GTGTGTACATACCCGTGTGCGGG - Intergenic
992247337 5:74839393-74839415 GTGTGTGCGCACGTGTGTGAAGG - Intronic
992939793 5:81750928-81750950 GTGAGTGTGCGCGCGTGTGAAGG + Intronic
993366803 5:87043533-87043555 GTGTGTGTGTGCACGTGTGCAGG + Intergenic
993485861 5:88484241-88484263 GTGTGTGTACATGCATGTGCAGG - Intergenic
993550711 5:89270424-89270446 GTGTGCGCGCGCGCGCATGCTGG - Intergenic
993901011 5:93584445-93584467 GTGTGTGTGCGCGGGGGTGCGGG + Exonic
995602941 5:113818249-113818271 GTGTATGCAGGCGTGTGTGCAGG + Intergenic
996082277 5:119269068-119269090 GTGTGCGTACGAGTGTGTGCAGG + Intronic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
997095705 5:130908747-130908769 GTGTGTGCATGTGCGTGTGTGGG - Intergenic
997485271 5:134225913-134225935 GTGCGTGTAGGCCCGTGTGCGGG - Exonic
998169252 5:139862666-139862688 GTGTTTGCACTTGTGTGTGCAGG + Intronic
1000665419 5:163989211-163989233 GTGTGTGTGCGCGCGCGTGTGGG + Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001245729 5:170104852-170104874 GTGTGTGCGCGTGCGTGCGTGGG + Intergenic
1001443221 5:171762196-171762218 GTGTGTGCACACGTGTGTCCTGG - Intergenic
1001552094 5:172610299-172610321 GTGTGCGCGCGTGAGTGTGCAGG - Intergenic
1001833973 5:174814920-174814942 GTGTGTGTACGTGTGTGTGTGGG - Intergenic
1001959900 5:175873276-175873298 GTGAGTGCGTGCGTGTGTGCAGG - Intronic
1001999735 5:176191025-176191047 CCGTGTGCAGGAGCGTGTGCAGG + Intergenic
1002167522 5:177357769-177357791 GTGTGTGCGCGTGTGTGTGTAGG + Intergenic
1003748747 6:9032203-9032225 GTGTGTGTATGTGTGTGTGCTGG - Intergenic
1004084291 6:12429515-12429537 GTGTGTGCACATGTGTGTGTTGG + Intergenic
1004351960 6:14898005-14898027 GTGTGTGCGCGTGTGTGTGGTGG - Intergenic
1004770806 6:18779093-18779115 GTGTGTGCATGCACGTGTATTGG + Intergenic
1004849214 6:19679527-19679549 GTGTGTGCGCGCGCATGTGGTGG + Intergenic
1006105575 6:31714287-31714309 GTGTGTGCATGTGGGTGTGTGGG - Intronic
1006458324 6:34144349-34144371 GTGTGTACGCGCGTGTGTGCTGG - Intronic
1006489318 6:34372981-34373003 GCGAGAGCACGCGCGTGTGCCGG + Intronic
1007600574 6:43078255-43078277 GTGTGTGCGCGCGTGTGTGTGGG + Intronic
1010354895 6:74921317-74921339 GTGTGTGCACGCTCATGAGTAGG - Intergenic
1010567034 6:77428716-77428738 GTGTGTGCACACGCATGTGTGGG + Intergenic
1011127855 6:84026196-84026218 GTGTGTGTGCGTGCGTGTGTGGG - Intergenic
1011159435 6:84371788-84371810 GTGTGTGCACGCGCATATGATGG + Intergenic
1013072601 6:106742513-106742535 GTGTGTGTGCGTGCGTGTGTGGG + Intergenic
1013786443 6:113786817-113786839 GTGTGTGCATGTGTGTGTGATGG + Intergenic
1017447391 6:154519261-154519283 ATGTGTGTGCGCGCGTGCGCAGG - Intergenic
1018916356 6:168134881-168134903 GGGTGTGCAGGAGGGTGTGCAGG + Intergenic
1019045241 6:169140376-169140398 GTGTGTCCACGTGCGTTTGCAGG + Intergenic
1019127906 6:169853544-169853566 GTGTGTGCACACACGTGCCCTGG + Intergenic
1019137380 6:169919048-169919070 GTGTGTGTGTGCGTGTGTGCAGG + Intergenic
1019183283 6:170206170-170206192 GTGTGTGCATGGGTGTGTGTGGG + Intergenic
1019295734 7:273049-273071 GTGTGTGCACACGAGTGTGTGGG - Intergenic
1019311480 7:363717-363739 GTGGGTGCTCGTGCGTGTCCTGG - Intergenic
1020033013 7:4946128-4946150 GTGGGTGTGCGTGCGTGTGCAGG - Intronic
1020033019 7:4946194-4946216 GTGTGTGCATGCGTGTGTGTGGG - Intronic
1021107627 7:16656542-16656564 GTGTGTGTGCGCGCGCGCGCTGG - Intronic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1022310976 7:29195219-29195241 GTGTGCGGACGCGGGTGTTCCGG + Exonic
1022965518 7:35467953-35467975 GTGTGTGCATGTGGGTGTGCTGG + Intergenic
1023109794 7:36797870-36797892 GTGTGTGTATGTGTGTGTGCAGG + Intergenic
1023620614 7:42068121-42068143 GTGTGTCTACACACGTGTGCAGG - Intronic
1023867761 7:44246567-44246589 ATGTGTGCATGCACGTGTGTGGG - Intronic
1024006127 7:45225897-45225919 GTGTGTGCACACACGTGTGGTGG + Intergenic
1024468477 7:49740089-49740111 GTGTGTGCGCATGCGTGTGTAGG - Intergenic
1024705047 7:51947803-51947825 GTGTGTGCACGCGCGAAGGTCGG + Intergenic
1024883767 7:54118105-54118127 GTGTGTGCGTGCATGTGTGCAGG - Intergenic
1026426433 7:70298933-70298955 GTGTGTGCACCCGTGTGGGCTGG - Intronic
1026572017 7:71539489-71539511 GTGTGTGCGTGCACGTGTACAGG + Intronic
1026890335 7:73977985-73978007 GTGTGTGCAAGTGTGTGTGCAGG + Intergenic
1026890342 7:73978145-73978167 GCGTTTGCAAGCGTGTGTGCAGG + Intergenic
1029294156 7:99526210-99526232 CTGTGTGGACGCGCTGGTGCTGG - Exonic
1031877662 7:127160522-127160544 GTGTGTGTGCGCGCGCGTGATGG - Intronic
1032013413 7:128360972-128360994 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
1032651603 7:133884615-133884637 GTGTGTGCGCGCGTGTGTGATGG + Intronic
1032841254 7:135715525-135715547 GTGTGTGCCAGTGTGTGTGCTGG + Intronic
1034071248 7:148187978-148188000 GTGTGTGCACGCATGTATGCGGG - Intronic
1034318629 7:150158863-150158885 CTGTGTGCACGTGTGTGTGTGGG - Intergenic
1034491052 7:151393294-151393316 GTGTGTGCACACAGGTGTGTGGG + Intronic
1034526857 7:151669963-151669985 GTGTGTGCACAGGTGTGTGCAGG - Intronic
1034774123 7:153808337-153808359 GTGTTTGCACGTGTGTGTGTGGG + Intergenic
1034783098 7:153899786-153899808 GTGTGTGCACAGGCAGGTGCAGG + Intronic
1035098471 7:156376932-156376954 GTGTGTGCACACATATGTGCAGG - Intergenic
1035226125 7:157433297-157433319 GTGTGTGCAGGCATGTGTGAGGG - Intergenic
1035243140 7:157545123-157545145 GTGTATGCATGGGTGTGTGCAGG + Intronic
1035360782 7:158312986-158313008 GTGTGTGCAGGTGAGTGTGCAGG + Intronic
1035636244 8:1146671-1146693 GTGTGTGCATGTGCCTGTGTAGG + Intergenic
1035717232 8:1763748-1763770 GCGTGCGAACGCGCGTGCGCGGG + Exonic
1036274251 8:7336651-7336673 GTGTGTGTGTGCGCTTGTGCTGG - Intergenic
1036347097 8:7973697-7973719 GTGTGTGTGTGCGCTTGTGCTGG + Intergenic
1036391603 8:8328763-8328785 GTGTGTGTGCGCACGCGTGCAGG - Intronic
1037926627 8:22848503-22848525 GTGTGTGCTCACTCCTGTGCAGG + Intronic
1038680259 8:29660379-29660401 GTGTGTGCACACGTGTGTATGGG - Intergenic
1038761292 8:30385328-30385350 TTGTGTCCACGCGCGTCTGCGGG + Intronic
1040404436 8:47086338-47086360 GTGGCTGCACTCCCGTGTGCTGG + Intergenic
1042196707 8:66237447-66237469 GTGTGAGCAAGCGAGTGTGGGGG + Intergenic
1043054125 8:75415759-75415781 GTGTGTGCACGTGTGTGTGTTGG + Intronic
1044037122 8:87320600-87320622 GTATGTGCACGTGTGTGTGTGGG + Intronic
1044311085 8:90693353-90693375 GTGTGTGCACGCACATGTGTAGG + Intronic
1045508266 8:102794175-102794197 ATGTGTGCACCTGTGTGTGCGGG + Intergenic
1045918297 8:107499829-107499851 GTGCGCGCGCACGCGTGTGCTGG - Intergenic
1046010223 8:108537487-108537509 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1046619197 8:116509934-116509956 GTGTATGCACGTGTGTGTGAGGG - Intergenic
1046760767 8:118017803-118017825 GTGTGTACATGATCGTGTGCAGG - Intronic
1047423565 8:124727079-124727101 GTGTGCGCGCGCGCGCGTGGGGG - Intronic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1048244050 8:132774815-132774837 ATGTGTGTACGCGCGTGCTCAGG - Intergenic
1048373450 8:133800737-133800759 GTGTATGCATGCGTGTGTGCGGG + Intergenic
1048493728 8:134918402-134918424 CTGTGTGCATGGGTGTGTGCAGG + Intergenic
1048697665 8:137046734-137046756 GTGTGTGTGTGCGCGTGTGCTGG + Intergenic
1048865371 8:138757034-138757056 GTGTGTGTGCACGTGTGTGCAGG - Intronic
1049016819 8:139925800-139925822 GCGTGTGCGTGTGCGTGTGCTGG - Intronic
1049251155 8:141589763-141589785 GTGTGTGCACACGTGTGTACAGG + Intergenic
1049398602 8:142413558-142413580 GTGTGTGCACGTGTGTGTGTGGG - Intergenic
1049407060 8:142456336-142456358 GTGTGCACATGCGTGTGTGCAGG - Intronic
1049420970 8:142516477-142516499 GTGTGCGCGCGCGTGTGTGCGGG + Intronic
1049488343 8:142877994-142878016 GTGTGTGCATGTGCAGGTGCCGG - Intronic
1049493234 8:142916024-142916046 GTGTGTGCATGTGCAGGTGCCGG - Intronic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049558589 8:143296266-143296288 CCGTGTGCACGCGCTGGTGCCGG - Exonic
1049558643 8:143296518-143296540 CCGTGTGCACGCGCTGGTGCTGG - Exonic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1049853004 8:144844297-144844319 CTGTGCGCACACGGGTGTGCTGG - Intronic
1050091283 9:2017556-2017578 GTGTGTGCGCGCGCGAGCGGCGG + Intronic
1050445789 9:5721435-5721457 GTGTGCACGCGCGTGTGTGCTGG - Intronic
1050485880 9:6134247-6134269 GTGTGTGCATGCACGTGTGACGG + Intergenic
1051167268 9:14277316-14277338 GTGCGTGCACGTGTGTGCGCGGG - Intronic
1051373173 9:16375913-16375935 GTGTGTGTGCGTGCGTGTGTGGG - Intergenic
1051868623 9:21711005-21711027 GTGTGTGCTTGCGTGTGTGGGGG + Intergenic
1052041074 9:23739782-23739804 GTGTGTGCGTGTGTGTGTGCAGG - Intronic
1052132857 9:24870851-24870873 GTGTGTGTACGTGTGTGTGTTGG - Intergenic
1052243658 9:26306712-26306734 GTGTGTGCGTGCGTGTGTGTTGG - Intergenic
1053284774 9:36843136-36843158 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1054841584 9:69747346-69747368 GTGTATGCACGTGCATGTGCTGG + Intronic
1056467912 9:86877152-86877174 GTGTCTGTCTGCGCGTGTGCTGG + Intergenic
1056910299 9:90694168-90694190 GTGTGTGAATGTGAGTGTGCGGG + Intergenic
1057042614 9:91858276-91858298 GTGGATGCATGCGTGTGTGCAGG - Intronic
1057401616 9:94728224-94728246 GTGTGTGCATGCGCGCACGCAGG - Intronic
1058873281 9:109220745-109220767 GTGTGTGCACGTGCGTGTGTTGG + Intronic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1059270464 9:113067530-113067552 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059271601 9:113072980-113073002 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059272732 9:113078424-113078446 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059273866 9:113083866-113083888 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059274999 9:113089310-113089332 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059332075 9:113542011-113542033 GTGTGTGCACGTGTGTGTGTTGG - Intronic
1059408677 9:114118367-114118389 GTGTGTGTAAGTGTGTGTGCAGG - Intergenic
1060201309 9:121653018-121653040 GTGTGTGCACAGGTGTGTGCTGG + Intronic
1060225705 9:121788999-121789021 GTGTGTGCGCACGCGCGTGCAGG - Intergenic
1060463867 9:123884982-123885004 GTGTGTGCGCGCGCGCTCGCAGG - Intronic
1060522702 9:124302756-124302778 GTGTGTGGACACAGGTGTGCGGG - Intronic
1060948589 9:127586240-127586262 GTGTGTGCGCTTGTGTGTGCGGG + Intergenic
1060996580 9:127877596-127877618 GTGCGTGCCCGCGCGTGTCTGGG - Intronic
1061330568 9:129889864-129889886 GTATGCGCACGCGTGTGTACTGG + Exonic
1062022457 9:134326051-134326073 GTGTGTGCGCGAGTGTGTGGCGG + Intronic
1062104264 9:134744498-134744520 GGGTGTGCATGAGTGTGTGCAGG - Intronic
1062253879 9:135611888-135611910 GTGTGTACAGGGGTGTGTGCAGG - Intergenic
1062253893 9:135611993-135612015 GAGTGTGCACGTGTGTGTGCAGG - Intergenic
1062267050 9:135691776-135691798 GTGTGTGCACACGCGTTCGTGGG - Intergenic
1062325562 9:136010927-136010949 GTGTGTGTGCGTGTGTGTGCAGG - Exonic
1185480175 X:440136-440158 GTGTGTGCACCTGTGTGTGTGGG - Intergenic
1185480190 X:440363-440385 GTGTGTGCACCTGTGTGTGGGGG - Intergenic
1185567995 X:1110978-1111000 GTGTGTGCATGCTAGTGTGTGGG + Intergenic
1185589717 X:1266722-1266744 GTGTGTGCAAGTGTCTGTGCAGG + Intergenic
1185589754 X:1267451-1267473 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1185589770 X:1267704-1267726 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1185589800 X:1268225-1268247 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1185589818 X:1268537-1268559 GTGTGTGTGCACGTGTGTGCGGG + Intergenic
1185710356 X:2298585-2298607 GTGTGTACACACGCGCCTGCAGG - Intronic
1186349899 X:8731008-8731030 GTGTGCGCGCGCGCTTGTGTGGG - Intronic
1186490596 X:9969424-9969446 GTGTGTGTGCGCGCGTGCACTGG - Intergenic
1187190479 X:17030339-17030361 GTGTGCACGCGCGGGTGTGCAGG + Intronic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1188668043 X:32848993-32849015 GTGTGTGTATGTGCATGTGCTGG + Intronic
1189364221 X:40375836-40375858 GTGTGTACACGCATGTGTGTGGG + Intergenic
1190544209 X:51508227-51508249 GTGTGTGTACGTGCATGTGTGGG - Intergenic
1192190204 X:68986529-68986551 ATGGGTGCACACGTGTGTGCAGG - Intergenic
1192436482 X:71146371-71146393 GTGTGTGTGCGTGTGTGTGCGGG + Intronic
1193208232 X:78774142-78774164 GTGTGTGTGTGCGCGTGTGTTGG - Intergenic
1196644712 X:118105070-118105092 GTGTGTGCACAGGTGTGTGTTGG - Intronic
1197559848 X:128006303-128006325 GTGTGTGCACGCGCACGCGTGGG - Intergenic
1197782490 X:130171890-130171912 GTGTGCGCGCGCGCGCGTGAAGG - Exonic
1198548575 X:137720038-137720060 GTGTGTGCAGGTGCCTGTGCAGG + Intergenic
1198671802 X:139089146-139089168 GTGTGTGCACGCATGTGTGTTGG + Intronic
1198950785 X:142069164-142069186 GTGTGTTCATGCGCATGTGTGGG - Intergenic
1201464301 Y:14263445-14263467 GTGTGTGCACGTGCATGTAAGGG - Intergenic
1201728361 Y:17180035-17180057 GTGTGTGTATGTGTGTGTGCAGG + Intergenic