ID: 1114612822

View in Genome Browser
Species Human (GRCh38)
Location 14:24053490-24053512
Sequence CACCCTACTCCCTCTCTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114612820_1114612822 -8 Left 1114612820 14:24053475-24053497 CCGGAGTTTTCTCCACACCCTAC 0: 1
1: 0
2: 1
3: 15
4: 163
Right 1114612822 14:24053490-24053512 CACCCTACTCCCTCTCTAATAGG 0: 1
1: 0
2: 0
3: 6
4: 109
1114612814_1114612822 20 Left 1114612814 14:24053447-24053469 CCGTCCCCTGACTCAGGGACATC 0: 1
1: 0
2: 0
3: 24
4: 267
Right 1114612822 14:24053490-24053512 CACCCTACTCCCTCTCTAATAGG 0: 1
1: 0
2: 0
3: 6
4: 109
1114612816_1114612822 16 Left 1114612816 14:24053451-24053473 CCCCTGACTCAGGGACATCAGGA 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1114612822 14:24053490-24053512 CACCCTACTCCCTCTCTAATAGG 0: 1
1: 0
2: 0
3: 6
4: 109
1114612817_1114612822 15 Left 1114612817 14:24053452-24053474 CCCTGACTCAGGGACATCAGGAG 0: 1
1: 0
2: 2
3: 27
4: 269
Right 1114612822 14:24053490-24053512 CACCCTACTCCCTCTCTAATAGG 0: 1
1: 0
2: 0
3: 6
4: 109
1114612818_1114612822 14 Left 1114612818 14:24053453-24053475 CCTGACTCAGGGACATCAGGAGC 0: 1
1: 0
2: 1
3: 17
4: 174
Right 1114612822 14:24053490-24053512 CACCCTACTCCCTCTCTAATAGG 0: 1
1: 0
2: 0
3: 6
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114612822 Original CRISPR CACCCTACTCCCTCTCTAAT AGG Intronic
900844451 1:5085433-5085455 GTCCCAACTCCCTCTCTCATTGG + Intergenic
901134280 1:6982932-6982954 CACCCTACTCACTCCTTCATGGG - Intronic
901787602 1:11635095-11635117 CATCTTACTGTCTCTCTAATCGG - Intergenic
905286926 1:36886839-36886861 CACACTACTCCCTCTCCCAGAGG + Intronic
905945786 1:41900618-41900640 CTCTCTATTCCCTCTCTACTGGG - Intronic
905974168 1:42163375-42163397 CAGCCTCCTTCCTCTCTGATTGG - Intronic
907576389 1:55529678-55529700 GACCCTACTCCATATCTAAGAGG - Intergenic
908520293 1:64935038-64935060 CTCCCTGCTCCCTCTGAAATAGG + Intronic
909556942 1:76964447-76964469 CACACTACTTTCTCTCTCATGGG + Intronic
910327212 1:86024036-86024058 CATCCTAAGCCCTCTCTATTAGG + Intronic
913565192 1:120066689-120066711 CACCCTACTGCCTCTCCTGTAGG - Intronic
913632937 1:120726870-120726892 CACCCTACTGCCTCTCCTGTAGG + Intergenic
914285781 1:146226046-146226068 CACCCTACTGCCTCTCCTGTAGG - Intronic
914546813 1:148676798-148676820 CACCCTACTGCCTCTCCTGTAGG - Intronic
914619751 1:149393870-149393892 CACCCTACTGCCTCTCCTGTAGG + Intergenic
915570541 1:156743094-156743116 CACCCTTCTCCCACTCTCCTAGG - Intronic
916350390 1:163842874-163842896 CAGACTACTCTCTCTCTAGTAGG - Intergenic
916720127 1:167478563-167478585 CACACTACTGCCTCTCCAATTGG - Intronic
921675736 1:217974335-217974357 CACACTTCTACTTCTCTAATTGG - Intergenic
923150974 1:231232877-231232899 CGGGCTACTCTCTCTCTAATTGG - Intronic
923313583 1:232758400-232758422 CATGTTACTCCCTCTATAATTGG + Intergenic
923466681 1:234253959-234253981 GACCCTACTGCCTCTCACATGGG + Intronic
1063331599 10:5165169-5165191 TACCCTCCTCCCTCTCCATTTGG + Intergenic
1063653413 10:7963102-7963124 CACCATACTCCCTCTCCAAGTGG + Intronic
1065373659 10:25015437-25015459 TGCACTACTCCCTCTCTAATGGG - Intronic
1073661780 10:105483613-105483635 CCCTCTACTCACTTTCTAATGGG + Intergenic
1078891913 11:15565342-15565364 CTCCCTACATCCTTTCTAATAGG - Intergenic
1079077925 11:17395296-17395318 GACCCTGCTCCCTCCCTACTGGG - Intronic
1084523661 11:69682742-69682764 CTCTCTGCTCCTTCTCTAATAGG + Intergenic
1088844260 11:113651712-113651734 CTCCCCACCCCTTCTCTAATAGG + Intergenic
1089124865 11:116169745-116169767 TACCCCACTCACTATCTAATGGG + Intergenic
1089328457 11:117673626-117673648 CCTCCTGCTCCCTGTCTAATTGG + Intronic
1089398889 11:118153107-118153129 CCCCCAACTCCCTCTCCAGTGGG + Intergenic
1089679091 11:120109572-120109594 CCCCCTCCTTCCTCCCTAATAGG + Intergenic
1094213027 12:27912450-27912472 CAACCTACTCTCTCTCTAAAGGG + Intergenic
1096119495 12:49078590-49078612 TCCCCTACTCCCTCTCTGCTGGG + Intergenic
1096419934 12:51448408-51448430 CACCATCCTCCATCTCAAATCGG - Intronic
1097268660 12:57760675-57760697 CACTCTACTCCCTCAAAAATTGG - Intergenic
1105947492 13:25202301-25202323 CAACCCAATCCCTCTCTAAGGGG + Intergenic
1112562041 13:100523743-100523765 CTCCCCGCTCCCTGTCTAATTGG - Intronic
1113100611 13:106713568-106713590 CACACTACTGCCTGTATAATGGG - Intergenic
1114612822 14:24053490-24053512 CACCCTACTCCCTCTCTAATAGG + Intronic
1117184693 14:53227796-53227818 CACCATGCTCCCTCCCTGATTGG - Intergenic
1118638422 14:67769394-67769416 CACCCTACTTTCTCTCTTAGTGG + Intronic
1119097879 14:71850982-71851004 CACCCTTCTCCCTATCTTCTGGG + Intergenic
1119610726 14:76059635-76059657 CATCCCACTCCCTCTCTCACTGG + Intronic
1126412945 15:48390704-48390726 CACCCTCGTCCCTCTCAATTAGG + Intergenic
1128566044 15:68700851-68700873 CTCCCTCCTCCCTCTCTCCTGGG - Intronic
1132316288 15:100892741-100892763 AACCCCACTCCCTCTCCAAATGG + Intronic
1133766083 16:8838756-8838778 CCCCTTACGCACTCTCTAATTGG - Intronic
1134649610 16:15898246-15898268 CCCCCAACCCCCTCTCTACTGGG + Intergenic
1138300121 16:55919058-55919080 TACCCCACTCCATCTCTAATCGG + Intronic
1143916672 17:10298858-10298880 CACCATTCTCCCTCCCCAATGGG - Intronic
1145949255 17:28803346-28803368 CACCCTGCTCTCTCACTACTTGG + Intronic
1155187078 18:23396522-23396544 CGCCCTCCTCCCACTCTAATTGG + Intronic
1159644698 18:70903673-70903695 CAGCTTCCTCCCTCTCTTATGGG + Intergenic
1160919388 19:1512806-1512828 CACCCTACCCCCTCCTCAATGGG + Intronic
1161717077 19:5882243-5882265 CCCATTACTGCCTCTCTAATGGG - Intronic
1163721185 19:18898987-18899009 CACCCACCTCCCTCCCTAAATGG + Intergenic
1165422382 19:35728661-35728683 CCCGCTACTCCCTCTCTATGTGG - Intronic
1168582512 19:57567280-57567302 TACCCTTCTCCCTCTCCATTTGG - Intergenic
927249172 2:20982625-20982647 CTCCATACTCCCTATCTCATGGG - Intergenic
933768507 2:85728094-85728116 CACCCTCCACCTTCTCAAATTGG - Intergenic
934123713 2:88865932-88865954 CTCCCTACTTCCTGGCTAATGGG - Intergenic
935264684 2:101384367-101384389 CACCCTTCTCCCACCCTAGTGGG - Intronic
938134407 2:128742628-128742650 CTCCCTACTCCCTCTGTGCTGGG + Intergenic
940076337 2:149746407-149746429 ACCCCTACTCCCTCCCTAGTTGG - Intergenic
940385331 2:153064742-153064764 CCCCCTACTCTGTCTCTCATTGG + Intergenic
942417576 2:175775168-175775190 CACCCTACACCCTCTACAAAGGG + Intergenic
943723304 2:191227930-191227952 CACCCTGTTCCCTGTCTTATGGG + Intergenic
948228347 2:236330802-236330824 CTCCCAACACCCTCTCTTATAGG - Intronic
1169505484 20:6207045-6207067 CAGCTTGCTCCCTCTGTAATTGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1173227624 20:41171171-41171193 CACCCTATCCCTTCTCTATTTGG - Intronic
1178231315 21:30788095-30788117 CACCCTACTCCCCATAAAATTGG - Intergenic
1179206150 21:39281348-39281370 CACCCTTCTCCCCCTAGAATGGG + Intronic
1181370569 22:22412052-22412074 CACCTTACTCCCTCAAGAATGGG - Intergenic
1181514827 22:23404565-23404587 GACCCCACCCCCTCTCTCATAGG + Intergenic
949097675 3:105484-105506 CACCCTACACTCTCTTTAAAAGG - Intergenic
949183406 3:1162447-1162469 CACACTTCTCCCTCTGTGATTGG - Intronic
950146702 3:10655254-10655276 CACTCTCCTCCCTCTCCTATTGG + Intronic
954309437 3:49753406-49753428 CACCCTCCACCCCCTTTAATTGG + Intronic
959230953 3:103650611-103650633 CCTCCTACTGCCTCTATAATGGG - Intergenic
959479966 3:106859340-106859362 CTCCCTAGTCCCACTCTATTGGG - Intergenic
964486078 3:157186369-157186391 GCCCCTACTACCTCTCTAAACGG - Intergenic
965386397 3:168051189-168051211 CCCCACACTCCCTCTCTACTTGG - Intronic
967291918 3:187929642-187929664 CACCCTAGTGTCTCTCTGATAGG - Intergenic
968676090 4:1881056-1881078 TAACCTACTCCCTCTCCCATAGG - Intronic
973122534 4:46540268-46540290 CACCTTCCTCTCTCTCTAAAGGG + Intergenic
979049752 4:115915590-115915612 CACTCTACTCCTTTTGTAATGGG + Intergenic
997444389 5:133930734-133930756 CACACTACACCCTCGCTAAAGGG + Intergenic
998261766 5:140637141-140637163 CACCCTACTCCCACTCTTGGGGG - Intergenic
999450833 5:151676793-151676815 CTTCCTACTCCCTCTGCAATGGG + Intronic
1004595328 6:17094116-17094138 CACCCAACTCCCACCCTACTAGG + Intergenic
1005476898 6:26216804-26216826 CACCTTATTTCCTTTCTAATTGG + Intergenic
1007934765 6:45723085-45723107 TCCCCTGCTCCCTCTCTAACTGG - Intergenic
1008670682 6:53765507-53765529 CAGCCTACACCCTGTCTATTTGG - Intergenic
1014218890 6:118780371-118780393 CCCCCTACTCCCTTGCTAGTTGG + Intergenic
1017663221 6:156694235-156694257 CACCATGCTCCCTCTCTGAAGGG - Intergenic
1018396216 6:163379815-163379837 CACCCTGCTTCCCCACTAATGGG - Intergenic
1027927756 7:84488924-84488946 GACTGTACTACCTCTCTAATAGG - Intronic
1037424439 8:18740299-18740321 CAACCTACTCTCTCTCTCCTCGG + Intronic
1037770321 8:21795103-21795125 CAGGTTCCTCCCTCTCTAATGGG - Intronic
1038850298 8:31269026-31269048 CTCCCAACTCCCTCTCTTTTTGG + Intergenic
1039797372 8:40926774-40926796 ATCCCTACTTCCTCTCCAATCGG + Intergenic
1041728242 8:61038330-61038352 CACCCTCCTTCCTCTCATATGGG - Intergenic
1042293530 8:67195195-67195217 CACTCTCCTCCCTCTAAAATAGG + Intronic
1042319081 8:67456298-67456320 CTCCCAAATCCCTCTCAAATTGG + Intronic
1045508530 8:102795421-102795443 CACCCTCCTCCCTCACAAAAAGG + Intergenic
1048571351 8:135659622-135659644 CACCCTACTCCCTCCCAGCTGGG - Intergenic
1049610091 8:143550911-143550933 CACCCTCCTCACTCTTTATTGGG + Intergenic
1052637845 9:31125554-31125576 CTCCCCACTCCCTTTCTACTTGG - Intergenic
1058200643 9:102035420-102035442 CACCCTCCTCAATATCTAATTGG - Intergenic
1186536196 X:10351221-10351243 CTCCATACTCCCTCTCTGCTTGG + Intergenic
1187578687 X:20585671-20585693 CACCCTATTCCTTCCCTTATGGG - Intergenic
1196992405 X:121344661-121344683 CCCCTTATTCACTCTCTAATTGG - Intergenic