ID: 1114613049

View in Genome Browser
Species Human (GRCh38)
Location 14:24054566-24054588
Sequence CTGGCCCAGGGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1009
Summary {0: 1, 1: 0, 2: 13, 3: 122, 4: 873}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114613049_1114613062 24 Left 1114613049 14:24054566-24054588 CCTTCCTCCTTCCCCTGGGCCAG 0: 1
1: 0
2: 13
3: 122
4: 873
Right 1114613062 14:24054613-24054635 CCCCACTCCTGGTTTTTCCTGGG 0: 1
1: 0
2: 3
3: 30
4: 443
1114613049_1114613060 23 Left 1114613049 14:24054566-24054588 CCTTCCTCCTTCCCCTGGGCCAG 0: 1
1: 0
2: 13
3: 122
4: 873
Right 1114613060 14:24054612-24054634 TCCCCACTCCTGGTTTTTCCTGG 0: 1
1: 0
2: 2
3: 31
4: 320
1114613049_1114613059 13 Left 1114613049 14:24054566-24054588 CCTTCCTCCTTCCCCTGGGCCAG 0: 1
1: 0
2: 13
3: 122
4: 873
Right 1114613059 14:24054602-24054624 AGCTCTCATGTCCCCACTCCTGG 0: 1
1: 0
2: 1
3: 22
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114613049 Original CRISPR CTGGCCCAGGGGAAGGAGGA AGG (reversed) Intronic
900637751 1:3674275-3674297 GTGGCCCACGGGAAGCGGGAGGG - Intronic
900956253 1:5888001-5888023 CTGGCCCAGGGAAACGGGGGAGG - Intronic
901002563 1:6155802-6155824 TTGGCACAGGGGAAAGAGGAGGG + Intronic
901295954 1:8161084-8161106 CAGGCCCAGAGGAAGTAAGAGGG - Intergenic
901551187 1:9997322-9997344 CTGGCCCTAGGTAAGGCGGAGGG + Exonic
901628163 1:10635156-10635178 GGGGCCCAGGGGAGGGAGAATGG - Intergenic
901840652 1:11952095-11952117 CTGGCCCAGGCCCAGGAGTAGGG + Intronic
902359628 1:15935337-15935359 CTTGCCCTTGGGAATGAGGATGG - Exonic
902374562 1:16024210-16024232 CTGCCCCAAGGCACGGAGGAGGG - Intronic
902379499 1:16045974-16045996 CTGCCCCAGGGCATGGAGGAGGG - Intronic
902470003 1:16642725-16642747 CTGGCCCAGCAGAGTGAGGAGGG + Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902821790 1:18947891-18947913 CTGGCTCAGGGTGAGGAGGCAGG - Intronic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
902988412 1:20169880-20169902 CTGGCCCAGGGAAGGAAAGAGGG - Intronic
903178793 1:21595250-21595272 CTGCACCAGTGGAGGGAGGAGGG - Intergenic
903376595 1:22870311-22870333 ATGGCCCCGAGGAAGGAGGCTGG + Intronic
903481178 1:23654506-23654528 CAGGCCCTAGGGAAGGAGGGAGG + Intergenic
903590320 1:24450744-24450766 CAGGCCACGGGGAAGGAAGATGG - Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904273398 1:29364942-29364964 CTGGCTCAGGGGCAGGCAGATGG + Intergenic
904400204 1:30251696-30251718 CTGGTCCATGGGCTGGAGGAAGG + Intergenic
904799288 1:33081480-33081502 CTGGCCCCCGCGAAGGAGGACGG + Exonic
905108668 1:35578660-35578682 TTGGCCCTGGAGAAGGAGGAGGG + Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG + Intergenic
905323973 1:37137362-37137384 CTGGCTCAGGGGGTGGAGGTGGG + Intergenic
905504368 1:38465498-38465520 CTGGGCCAGAGGCAGGAGGAGGG - Intergenic
905734422 1:40315975-40315997 CTGGCACAGTGGAAGGAGTCGGG - Intronic
906528255 1:46508912-46508934 CTGGGGCAGGGGAAGGAGTGGGG - Intronic
906561386 1:46760401-46760423 CAAGCCCAGGAGAAGTAGGAAGG - Intronic
906687520 1:47772076-47772098 CTGGGCCAGGGAGAGGGGGAAGG + Intronic
906955832 1:50372903-50372925 ATGGCCCATGGGTAGGAAGAAGG - Intergenic
907306799 1:53517800-53517822 CTGGCCCCGGGGCAGGGGCAAGG - Intronic
907491307 1:54810576-54810598 CCGGCCCTGGGGAAGCAGGATGG - Intronic
907832461 1:58078028-58078050 CTGGCCCCAGGGAAGGAGAGAGG + Intronic
908356863 1:63330426-63330448 CTGGACCCCGGGAAGGAGCATGG - Intergenic
910207126 1:84759310-84759332 CAGGGCCACGGGAAGGAGGTGGG - Intergenic
910758034 1:90711815-90711837 CTGCCCCAGAGAAAAGAGGAGGG - Exonic
911070105 1:93825639-93825661 TTGGCCCTGGGGAAGGAGGGTGG - Intronic
911635572 1:100231870-100231892 CTGCGCTAGGGAAAGGAGGATGG - Intronic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
913168286 1:116209503-116209525 CTGCCCCAGAGAAAGGGGGAAGG - Intergenic
913175369 1:116268217-116268239 CTGGCCAAGGCTGAGGAGGAGGG - Intergenic
913518151 1:119622623-119622645 CTGACCCAGGGGAAGGAAGTGGG - Exonic
914918392 1:151831822-151831844 AGGGCCCAGGGGAGGGAGGAGGG + Exonic
914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG + Intergenic
915073843 1:153293283-153293305 CTGGCCCAGGAGACGGAGCGAGG + Intergenic
915093596 1:153443767-153443789 CCTCTCCAGGGGAAGGAGGATGG + Intergenic
915622977 1:157097530-157097552 CTGGGGCAGGTGAAGGAGGTGGG - Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
915882527 1:159687137-159687159 CTGGCCAAGGGGAAGGGCCATGG - Intergenic
915914777 1:159934374-159934396 CTGGCCCAGGGGAAGGGAGCAGG + Intronic
916501603 1:165392378-165392400 GTGGCCCAGTGGAAGGAGCAGGG - Intergenic
916715305 1:167442614-167442636 CTGGCCCAGGGGCAGGAAGGGGG - Intronic
916983742 1:170167674-170167696 CTGGGCCAGGAGAAGCAGGATGG + Exonic
917210682 1:172628940-172628962 CAGGCCCAGGTAAAGCAGGAGGG - Intergenic
917595985 1:176529532-176529554 CTGGGGCAAGGGGAGGAGGAGGG + Intronic
917927858 1:179803948-179803970 CAGGCCAGGGGGCAGGAGGAGGG - Intronic
918149138 1:181783041-181783063 CAGGCTCTGGGGTAGGAGGATGG - Intronic
918340483 1:183564192-183564214 CTCGCCCTGGGGAAGCATGAAGG + Intronic
918851209 1:189693002-189693024 CTGGTGCTGGTGAAGGAGGAAGG - Intergenic
919274946 1:195401724-195401746 TTGGCCTGGGGGCAGGAGGAGGG + Intergenic
919832357 1:201550868-201550890 CTGACCCAGAGGATGGAGGTTGG + Intergenic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920182531 1:204141281-204141303 CTGGCCCTGGGGCAGCAGCAGGG - Intronic
920182926 1:204143604-204143626 CTGCCCCAGGGCCAGCAGGAGGG + Intronic
920210822 1:204327058-204327080 CTATCCCAGGAGGAGGAGGAGGG - Intronic
920231836 1:204475824-204475846 CTGGCCCAGAGCCAGGAGGATGG - Intronic
920243826 1:204573285-204573307 CTGGCCCAGGCCACAGAGGAGGG - Intergenic
920398183 1:205661274-205661296 CTGCCACAGGGGAAGGGGAAGGG + Intronic
920681554 1:208077002-208077024 CTTTCACAGGGAAAGGAGGATGG + Intronic
921092921 1:211860222-211860244 CAGGACCAGGGGAAGAAGGAAGG + Intergenic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
921263967 1:213407030-213407052 CTGGCCCAGGTGTGGGAGAAAGG + Intergenic
921553983 1:216574914-216574936 CTTTCCCAAGGGAAGGAGGGAGG - Intronic
921774207 1:219078561-219078583 CTGGCCCTGGAGGGGGAGGATGG - Intergenic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922585909 1:226735542-226735564 CTGGTCCAGGGTATGCAGGAAGG + Exonic
922720913 1:227899908-227899930 TTGGGCCAGGGGTAGGAGGCGGG + Intergenic
923701474 1:236303965-236303987 CTGGCCCAGGGCAAAGAAGCAGG - Intergenic
923756695 1:236797364-236797386 TGTGCCCTGGGGAAGGAGGATGG + Intronic
923791519 1:237115237-237115259 CTGGCCCAGAGCAAGGGGGGGGG - Intronic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
1063102568 10:2963257-2963279 CAGGCCCAGGAGATGGAGGGTGG - Intergenic
1063189193 10:3678250-3678272 CTGGCCCAGAAGGAGGAGTAAGG - Intergenic
1063999752 10:11653750-11653772 CTGTTCCAGGGGAAGTATGATGG - Intergenic
1064310545 10:14208518-14208540 CCTGCCTTGGGGAAGGAGGAGGG + Intronic
1064592720 10:16910972-16910994 CTAGCCCAGGAGAAGAATGAAGG + Intronic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1065144254 10:22751959-22751981 CTGGCCCAATGGCAGGGGGAAGG + Intergenic
1065588174 10:27240606-27240628 CACGCCCCGGGGGAGGAGGAAGG - Intronic
1065698355 10:28401164-28401186 CTGGCCTTGGAGATGGAGGAAGG - Intergenic
1065947851 10:30623825-30623847 GTGGACGAGGGGGAGGAGGATGG - Intronic
1066746456 10:38606480-38606502 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1067346954 10:45443981-45444003 CTGGCCGCGGGGAAAGAGGATGG + Intronic
1067530269 10:47066072-47066094 GGGGCCCAGGGCAAGGAGCAGGG - Intergenic
1067790715 10:49285488-49285510 AGGGCCTGGGGGAAGGAGGATGG + Intergenic
1067796857 10:49327145-49327167 GTGGGCCAGGAGAGGGAGGAAGG - Exonic
1069577783 10:69543267-69543289 CTGACACTGGGGCAGGAGGAAGG - Intergenic
1069949801 10:72010903-72010925 TTGGCCCAGAGTAAGAAGGAGGG - Exonic
1070298882 10:75188399-75188421 ACAGCCCAGGGGAGGGAGGAGGG - Intergenic
1070500733 10:77070443-77070465 CCGGCCTAGGGGAAGGGAGAGGG + Intronic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1070736278 10:78865840-78865862 CTGGCCTGGGGGAAGGCAGAAGG - Intergenic
1070825438 10:79387865-79387887 CTGGGCCAGGGGCAGAAGGGTGG - Intronic
1070956638 10:80468155-80468177 CGGGCCCAGAGGATGGAGGCTGG - Intronic
1072047879 10:91674851-91674873 CCAGCCAATGGGAAGGAGGAAGG - Intergenic
1072619040 10:97067809-97067831 CTGGCCCAGGAGGAGGAGGTGGG - Intronic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1072751797 10:97986078-97986100 CTGGGCTCTGGGAAGGAGGAAGG + Intronic
1072902292 10:99419230-99419252 CTGACCCAGGGGAATGATAATGG + Intronic
1073123413 10:101135301-101135323 CGGGCCTTGGGGCAGGAGGAAGG + Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073536502 10:104281383-104281405 CTGGACCAGGGAAAGGAGCTGGG + Intronic
1074317633 10:112373868-112373890 CTACCTCAGGGGAAGGAGAAGGG - Intergenic
1074339934 10:112618599-112618621 TTGGCCTAGGGGAAGGAGGAAGG + Intronic
1074507755 10:114086597-114086619 CTGACCCAGGGGAGGGAAGCTGG - Intergenic
1075574763 10:123570403-123570425 CAGGCTCTGGGGAAGGAGGAAGG - Intergenic
1075914344 10:126154577-126154599 CTGCCCTCTGGGAAGGAGGAAGG - Intronic
1076109800 10:127851683-127851705 GTGCCCCAGGGGAAGGAGGCAGG + Intergenic
1076150595 10:128159263-128159285 GTGGCCCAGGGGAGTGAGGGGGG + Intergenic
1076204046 10:128581233-128581255 GTGGCCCATGGGAAAGAGGCTGG + Intergenic
1077015902 11:399112-399134 CTGGCCCTGGTGGAGGAGAACGG + Exonic
1077140420 11:1021889-1021911 CTGGCCCAAGTGGTGGAGGAGGG - Intronic
1077190533 11:1254325-1254347 ATGGTGCATGGGAAGGAGGAGGG + Exonic
1077282209 11:1750915-1750937 CAGGCCCTTGGAAAGGAGGAGGG - Intronic
1077285165 11:1762360-1762382 GTGGCCCTGGGGGAGGAGCAGGG - Intronic
1077369630 11:2175492-2175514 CTGGCCCCTGGGAAGGAGAAGGG + Intergenic
1077386684 11:2272540-2272562 CTTGACAAGGGGAAGGAGGGAGG - Intergenic
1077425492 11:2474039-2474061 CTGGGCCAGCGGTAGGAGGCTGG - Intronic
1077439147 11:2560145-2560167 CCAGCCCAGGGGAATGAGGGGGG + Intronic
1077477574 11:2797672-2797694 CGGGGCCCGGGGGAGGAGGAGGG - Intronic
1077522352 11:3043778-3043800 CAGGCCAAGGGGAGGAAGGAGGG + Intronic
1077578122 11:3399647-3399669 CTGGCCTAGGGGTAGCAGCAGGG - Intergenic
1078084032 11:8223092-8223114 ATAGCCCCTGGGAAGGAGGAGGG + Intergenic
1078196051 11:9137994-9138016 CAGGCCCAGGGGATGGAGACAGG + Intronic
1078610694 11:12816618-12816640 GTGGGCCAGTGCAAGGAGGAGGG + Intronic
1078744938 11:14103514-14103536 CTGGCCCAGTGGTGGGAGGATGG - Intronic
1079240602 11:18719889-18719911 GTGCCCTAGGAGAAGGAGGAAGG + Exonic
1079627794 11:22635887-22635909 CTGCCCCAGGCCATGGAGGAAGG - Intronic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1080429593 11:32185942-32185964 CTGGCCCAAGGGAAGTGGGAAGG - Intergenic
1080429662 11:32186454-32186476 GTAGCCCAGGTGAAGGATGAAGG - Intergenic
1080663534 11:34316156-34316178 CCGTCCCTGGGCAAGGAGGAGGG + Intronic
1080744962 11:35100602-35100624 CTAGCCCAGGGGTGAGAGGAAGG + Intergenic
1080852460 11:36081676-36081698 CTGGCACAGGGGAAGAAGGTTGG - Exonic
1081296212 11:41392811-41392833 GTGGCCCAGAGGAAGCAGGAAGG + Intronic
1081379324 11:42395117-42395139 CTGGCACATGTGAATGAGGACGG + Intergenic
1081652780 11:44835487-44835509 CTGCTCCCAGGGAAGGAGGAAGG + Intronic
1083089330 11:60184022-60184044 CTCCCCCAAGGAAAGGAGGAAGG - Intronic
1083242264 11:61397705-61397727 CTGGCCCAGGGGAAAGGCGTGGG - Intronic
1083269528 11:61564816-61564838 CTGGGCCAGTGGATGGGGGAAGG - Intronic
1083479197 11:62932984-62933006 CTGGCCCAGGGGATGGCAGTGGG + Intergenic
1083595616 11:63917243-63917265 CTGGCCCTGGGGTGGGAGGGAGG + Intergenic
1083611661 11:64007323-64007345 CTGGCCCCGAGGAAGGAGGGAGG + Intronic
1083784252 11:64934739-64934761 GTGACCCAGGGGAGGAAGGAGGG + Exonic
1084026888 11:66456155-66456177 CTGGAGCAGGGGAGGGAGGGAGG + Intronic
1084215371 11:67644573-67644595 CAGGGCCAGGGGAAGTGGGATGG + Intronic
1084483566 11:69435437-69435459 CTGGCCCAGGGTAAGGATATGGG - Intergenic
1084512601 11:69615638-69615660 CTGGCCCAGGGCATGCAGGATGG - Intergenic
1084564499 11:69921436-69921458 GTGTCCCAAGAGAAGGAGGAGGG + Intergenic
1084589028 11:70079447-70079469 CTGGCCCTGGGGAGGGTGGTGGG - Intronic
1084769602 11:71334226-71334248 TAGGCCCAGGAGAAGGAGGGAGG + Intergenic
1084773653 11:71360894-71360916 CCAGGCCAGGGGAAAGAGGAAGG + Intergenic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085509711 11:77082114-77082136 CTGTCCCAGGGGCACCAGGATGG + Intronic
1085521176 11:77139689-77139711 CTGGCTCAGAGGGAGAAGGAAGG - Intronic
1085644625 11:78214961-78214983 CAGCCCCTGGGGAAGGAGGTAGG - Intergenic
1086089696 11:82993160-82993182 CTGGAGCAAGGAAAGGAGGAAGG - Intronic
1086184689 11:83999212-83999234 CTGGCCCAGAGGGTGGAAGAAGG - Intronic
1087181118 11:95143625-95143647 CAGGGCCAGTGGCAGGAGGATGG + Intergenic
1088363280 11:109013262-109013284 GTGACCCTGTGGAAGGAGGATGG - Intergenic
1088413061 11:109556869-109556891 CGGGCTTGGGGGAAGGAGGAGGG + Intergenic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1088972004 11:114781761-114781783 CTGGTGGAGGTGAAGGAGGAAGG - Intergenic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1089016067 11:115166460-115166482 ATGGGGCTGGGGAAGGAGGAGGG + Intergenic
1089070968 11:115699422-115699444 CATGCCCAGGGGAAGGGGCATGG - Intergenic
1089207968 11:116780270-116780292 CTGGCCCAGTTGAAGGTAGAGGG + Intronic
1089207999 11:116780465-116780487 CTGGCCCAGTTGAAGGTAGAGGG - Intronic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089309309 11:117547387-117547409 CTGGGCCTTGGGGAGGAGGATGG + Intronic
1089399485 11:118156237-118156259 ATGCCCCAGGGGAAGTCGGATGG + Intergenic
1089607584 11:119650564-119650586 CTGGCATCAGGGAAGGAGGAAGG - Intronic
1089685246 11:120142406-120142428 CTTGCCCAGGGGCAAGGGGATGG - Intronic
1090028247 11:123185636-123185658 CTCCCCCAGGGGAAGGCAGATGG + Intronic
1090071217 11:123546206-123546228 CTGACCTCAGGGAAGGAGGATGG + Intronic
1090235354 11:125142824-125142846 ATGGACAAGGGGAAGGAGTAAGG + Intergenic
1090334193 11:125951768-125951790 ATGGCCCTGTGGAAGGAGGAAGG - Intergenic
1090464748 11:126924180-126924202 CTGAGCCAGGGAAAGGGGGAAGG - Intronic
1090482112 11:127078020-127078042 CTGGGCTGGGGGCAGGAGGATGG - Intergenic
1090624231 11:128591985-128592007 CAGGCCCAGTGGAACCAGGATGG - Intergenic
1090875302 11:130783753-130783775 CTGACCCAGAGGCAGGAGAATGG - Intergenic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1091255693 11:134183062-134183084 CTGGCCCAGGGCCATTAGGACGG - Intronic
1091582200 12:1796855-1796877 CTGGCCCCGGGGAGGCAGGGAGG - Intronic
1091769416 12:3141447-3141469 CAGGGCCCGGGGCAGGAGGAAGG - Intronic
1091781541 12:3217198-3217220 GAGGCCCAGGGGCAGGTGGAAGG - Intronic
1091787977 12:3254425-3254447 CTGACCCAGGGGAAGGGGCAAGG - Intronic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1092064876 12:5581684-5581706 CATGGCGAGGGGAAGGAGGAGGG - Intronic
1092181784 12:6451375-6451397 CTGGCTCAGGGGGAGCAGGCAGG - Exonic
1092242103 12:6841401-6841423 GTGGCCCAGGGGGAGGGGGCTGG + Intronic
1092261787 12:6956796-6956818 GTGGGGCAGGGGTAGGAGGAAGG - Intronic
1092280361 12:7093209-7093231 CAGGCCCCTGGGAGGGAGGAGGG + Intronic
1092745287 12:11667180-11667202 CTGGCACAGAGGAAGGCCGATGG + Intronic
1093542647 12:20305366-20305388 TTGGCTCCGGGGAAGAAGGAGGG - Intergenic
1093971706 12:25382108-25382130 CTGGCACAGGGCAAGGTGTATGG - Intergenic
1094040310 12:26114615-26114637 CTGGAGCAGGGAAGGGAGGAAGG + Intergenic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094731354 12:33179867-33179889 TTTGCACAGGGGAAGGGGGAGGG - Intergenic
1095206385 12:39443766-39443788 CTGACTCCGGGGAGGGAGGAGGG - Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096400213 12:51299715-51299737 CTGACCCAGGGTAATGAGAAAGG + Intronic
1096478757 12:51924269-51924291 CAGGCACAGGGGAAGGGGAAAGG - Intergenic
1096504116 12:52082023-52082045 AGGGCCCCGGGGAAGCAGGATGG - Intergenic
1096504619 12:52084914-52084936 CTGGACCAGGGGTAAGAAGAGGG + Intergenic
1096542748 12:52317415-52317437 CTGGCTCAGGGGAAGGATGCAGG + Intronic
1096619021 12:52850886-52850908 TGGGGCCAGGGGAAGGAGGAAGG - Intergenic
1096677899 12:53235324-53235346 CTTGCCTAGGGGGAGGAGGTGGG - Intergenic
1096846536 12:54410228-54410250 GTGGAGCAGGGGCAGGAGGATGG + Intronic
1098006933 12:66007518-66007540 GTGGGACAGGGGAAGGAGGGAGG - Intergenic
1098102400 12:67031946-67031968 ATGGCCCAAGGCACGGAGGAGGG - Intergenic
1098385062 12:69909773-69909795 CATGTCCAGGGGAAGGAGGGTGG + Intronic
1098550846 12:71759521-71759543 CTTACTCAAGGGAAGGAGGAGGG - Intronic
1099732696 12:86525914-86525936 CTGGCACATGCGAATGAGGACGG - Intronic
1102522225 12:113485529-113485551 CTGGCTCAGGGGAGAGAGGGCGG - Intergenic
1102573558 12:113842276-113842298 CTGGCCCCGGGGTTGGGGGATGG + Intronic
1102790316 12:115639188-115639210 CACGCCCAGGGGAGGAAGGAAGG + Intergenic
1103568299 12:121828100-121828122 CAGGGCCAGGGGCAGGAGCAGGG - Intronic
1103830531 12:123775626-123775648 TTGGCCCAGTAGCAGGAGGATGG + Intronic
1103944600 12:124518922-124518944 CTGGCCCTCGGGACAGAGGACGG - Intronic
1104714204 12:131005753-131005775 CTGGCTCAGGGGATGGAGCAGGG + Intronic
1104736396 12:131138264-131138286 CCGAGCCTGGGGAAGGAGGATGG - Intronic
1104756656 12:131273715-131273737 CTGGCCCCCGGGATGGAGGGTGG + Intergenic
1104903015 12:132199217-132199239 CTGGACCAGGGAGCGGAGGACGG - Exonic
1104926186 12:132315095-132315117 GTGGCCCAGGGGGAGGTGGTGGG + Intronic
1105422315 13:20264036-20264058 CTGGCCCAGGGGAAAGGCAAGGG - Intergenic
1105811149 13:23996798-23996820 CTGGCTCTGGAGATGGAGGAGGG - Intronic
1106480390 13:30133187-30133209 CTGGCTCTGGGGAAAGAGGGTGG - Intergenic
1106615461 13:31323097-31323119 CTGTTGCAGGGGACGGAGGAGGG + Intronic
1107062294 13:36172741-36172763 CTAGCGCAGGTGAGGGAGGAAGG + Intronic
1107885064 13:44868178-44868200 CTGGCTTACGGGAATGAGGAAGG - Intergenic
1108316740 13:49244055-49244077 ATAGCCCAGGGAAAGAAGGAAGG - Intergenic
1110455846 13:75689667-75689689 CTGGCACAGGAGAAAGATGAAGG - Intronic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111994441 13:95150490-95150512 CTGGCAGTGGGGAAGGGGGAGGG - Intronic
1111996919 13:95174660-95174682 GTCGCCGCGGGGAAGGAGGAAGG - Intronic
1112326361 13:98444945-98444967 CTGCCACTGGGGGAGGAGGATGG + Intronic
1113088809 13:106595883-106595905 CAGGCCCAGTGGAAGGAGTGAGG + Intergenic
1113433117 13:110267254-110267276 ATGACCCAGTGGAGGGAGGAGGG + Intronic
1113541083 13:111110247-111110269 GTGGCCCAGGGGAAGGCTGCAGG + Intergenic
1113650108 13:112028499-112028521 ATGGCCCAGAGGAAGGAGGGAGG + Intergenic
1113697103 13:112354473-112354495 CTGGCCCCAGGGAGGGAGGCCGG - Intergenic
1113767936 13:112892672-112892694 CTGGGCTCAGGGAAGGAGGAGGG - Intergenic
1113894771 13:113756890-113756912 CAGGCCCAGGGGGAGCAGCAAGG - Intergenic
1113910273 13:113838392-113838414 CTAGCCCCGGAGCAGGAGGAAGG + Intronic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1115430315 14:33309898-33309920 CTGGCCCTGCAGAGGGAGGAGGG + Intronic
1115857763 14:37649447-37649469 CTGGCCCAGAGGAAGTTGGCAGG - Intronic
1117438729 14:55741369-55741391 GAGGCCTGGGGGAAGGAGGAGGG + Intergenic
1117602447 14:57390130-57390152 CTGACCAGGGGCAAGGAGGATGG - Intergenic
1117667299 14:58070017-58070039 CTGGCTGAAGGCAAGGAGGATGG + Intronic
1117790106 14:59331367-59331389 GAGGCCCTGGGGGAGGAGGAGGG - Exonic
1118156753 14:63250118-63250140 GTGGCCCAGGGAAAAGATGATGG - Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119264963 14:73259171-73259193 ATGGTCCAGGGGACGGAGGAAGG + Intronic
1119477360 14:74938883-74938905 TTGGCCCAGGGGAGTGGGGAGGG + Intergenic
1119542386 14:75448976-75448998 CTGGCCCGGAGGATGGAAGAGGG - Intronic
1119568831 14:75651844-75651866 ATGCCCCAGGGCAAGGAGGAAGG + Exonic
1119825401 14:77653650-77653672 CTCCCCCAGTGGCAGGAGGAAGG + Intergenic
1120826744 14:88963052-88963074 CTATCCGAGGGGAAGGAGAAGGG - Intergenic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1121020990 14:90580027-90580049 CAGGCCCCAGGGAAGAAGGAGGG - Intronic
1121390642 14:93570538-93570560 CTGGGCCATGTGCAGGAGGAAGG + Intronic
1121810797 14:96887832-96887854 TTGGGGCAGGGGAAGGAGTAGGG - Intronic
1122151139 14:99726810-99726832 GTGGCCCAGGGGACGGGGCAGGG - Exonic
1122328867 14:100899577-100899599 CTCTCCCAGGGGAAGGGAGAAGG + Intergenic
1122356445 14:101125808-101125830 CTGGGCCGGAGGCAGGAGGAGGG - Intergenic
1122404144 14:101489560-101489582 CTTGCCCAGTGTAAAGAGGAAGG + Intergenic
1122457412 14:101865103-101865125 CTGGTTCAGGGGAAAGAGCATGG + Intronic
1122748720 14:103917359-103917381 CTGGACTATGGGAAGGAAGATGG + Intronic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1122876175 14:104666388-104666410 CCGGCCCTGGGGGAGGAGGGAGG - Intergenic
1122906691 14:104804938-104804960 CTTGCCCTGGGGAAGGAGGCTGG + Intergenic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1122982635 14:105198530-105198552 CTGGACCAGGGACAGGAGCAAGG + Intergenic
1122999731 14:105286914-105286936 CTGGCCTGGGGCAAGGGGGACGG - Intronic
1123448275 15:20345014-20345036 TTGTCCCAGGGATAGGAGGATGG - Intergenic
1123449125 15:20349409-20349431 CTGGCCCTGGGTGAGCAGGACGG - Intergenic
1124160916 15:27269058-27269080 CTGGCCAAGATGAAGGAAGAAGG - Intronic
1124606300 15:31172381-31172403 CTGGCCCAGGGAGTGGAGGCCGG + Intergenic
1125332673 15:38597541-38597563 AAGGTCCAGGGGAAGGAAGAAGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125514314 15:40309222-40309244 CTGGTCCAGGGCAGGGTGGAGGG + Intergenic
1125611816 15:40976526-40976548 CAGCCTCAGGGGAAGAAGGAAGG - Intergenic
1126074982 15:44900475-44900497 CTGGCCCTTGAGATGGAGGAAGG + Intergenic
1126083382 15:44987341-44987363 CTGGCCCTTGAGATGGAGGAAGG - Intergenic
1127536046 15:59890777-59890799 CAAGCCCAGGGAAAGGTGGATGG + Intergenic
1128171477 15:65517449-65517471 CCGGCGCAGGAGAAGGAGAAGGG + Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128350006 15:66882178-66882200 CTGTCCCAGGGAGAGGAGGCCGG + Intergenic
1128539645 15:68517703-68517725 AGGGCCCAGGGAGAGGAGGATGG + Intergenic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1128720447 15:69943763-69943785 GAGGGCCAGGGGAAGGAGGCTGG + Intergenic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1128866827 15:71120577-71120599 CTGGCCAAGGGCCAGGAGGGTGG - Intronic
1129155045 15:73712482-73712504 GAAGCCCAAGGGAAGGAGGAGGG + Intronic
1129297620 15:74608618-74608640 CTGGCCCAGGGGCAGGTGGGAGG - Intronic
1129670119 15:77603071-77603093 CTGGCCCAGAGTCAGGAGAAAGG + Intergenic
1129946804 15:79545641-79545663 CTGGGACAGGTGAAGGAGGGGGG - Intergenic
1130415080 15:83686007-83686029 CCAGACCAGGAGAAGGAGGAGGG - Intronic
1130577784 15:85107577-85107599 CTGACCCAGTGGAAGGAGAGGGG + Intronic
1130913193 15:88284834-88284856 CTGGACCCAGGCAAGGAGGAGGG - Intergenic
1131091083 15:89625362-89625384 CTGGCCCAGGAGGAAGAGGGCGG + Exonic
1131559140 15:93424347-93424369 CTGGCCCAGGGGGTGGTGGAGGG - Intergenic
1131694332 15:94859054-94859076 GTGGCACAGGGGAATGGGGATGG - Intergenic
1132198181 15:99929454-99929476 CTGGCTTTGGGGATGGAGGACGG + Intergenic
1132415161 15:101614189-101614211 CTGCTCCTGGGGAAGGAGGAAGG - Intergenic
1132575296 16:661189-661211 GTGGCCCTGGGAGAGGAGGAGGG - Intronic
1132679089 16:1132432-1132454 CTGCCCCACGGGGAGCAGGAGGG - Intergenic
1132784038 16:1644627-1644649 CTGGCCCAGGGAAAGGAAGGTGG + Intronic
1132815167 16:1822370-1822392 GTGGCCCCGGGGAAGGACAAAGG + Intronic
1132870167 16:2112326-2112348 CTGCCCCAGGTGAGGGATGAGGG - Exonic
1133020084 16:2963414-2963436 CGGGCCCAGGGGGAGGGGGCGGG + Intergenic
1133116076 16:3578718-3578740 GTGGCTCAGGGGAGGTAGGAGGG + Intergenic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133526031 16:6606513-6606535 CTCGTAGAGGGGAAGGAGGAGGG - Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133716892 16:8458565-8458587 CTGCCAGAAGGGAAGGAGGATGG + Intergenic
1134058073 16:11182597-11182619 CTGGGCCGAGGGAAGCAGGAAGG + Intergenic
1134150044 16:11797931-11797953 CTGCCCCATGGGATGGAGGGCGG + Intergenic
1134378397 16:13701229-13701251 CAGGCCCAGGAGAAGGGGTAAGG - Intergenic
1134522378 16:14924630-14924652 CTGCCCCAGGTGAGGGATGAGGG + Intronic
1134710048 16:16323281-16323303 CTGCCCCAGGTGAGGGATGAGGG + Intergenic
1134717261 16:16363281-16363303 CTGCCCCAGGTGAGGGATGAGGG + Intergenic
1134949555 16:18345364-18345386 CTGCCCCAGGTGAGGGATGAGGG - Intergenic
1134957491 16:18388878-18388900 CTGCCCCAGGTGAGGGATGAGGG - Intergenic
1135154595 16:20041544-20041566 CTGGACCCTGGGATGGAGGAAGG + Intronic
1136062819 16:27738261-27738283 CTGGAGCCAGGGAAGGAGGAAGG + Intronic
1136093866 16:27939724-27939746 CTGGCCTGGGGGACCGAGGAAGG + Intronic
1136251687 16:29009537-29009559 ATGTCCCAGGGCCAGGAGGAGGG - Intergenic
1136366121 16:29809982-29810004 GTGTCCCAGGGGAAGCAGGCTGG + Intronic
1136381475 16:29898066-29898088 CAGGCCCAGCTGATGGAGGAGGG - Intronic
1136448744 16:30340201-30340223 CTGGCCCAGGTGCAGGGGCATGG - Intergenic
1136478665 16:30527740-30527762 CAGGCGCTGGGGAAGGTGGAGGG - Intronic
1136483798 16:30558275-30558297 CGGGCCCAAGGGAAGGAGGGAGG + Exonic
1136518533 16:30782216-30782238 TTGGCCTAGGGGAAGGCGCAGGG - Exonic
1136540043 16:30923913-30923935 CGGGCCCAGGGGAGGGGGGCAGG + Intronic
1136545344 16:30951149-30951171 CTGGGCCTGGGGAAAGAAGAAGG - Intronic
1136736605 16:32473162-32473184 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
1137249778 16:46732960-46732982 TGGGCCCAGGGGAAGGTAGAGGG - Intronic
1137384580 16:48029775-48029797 GAGGCACGGGGGAAGGAGGAGGG + Intergenic
1137610064 16:49811984-49812006 CAGGCCTAGGGGCAGGAGGAAGG - Intronic
1137617815 16:49857386-49857408 CTGCACCGGGGGCAGGAGGAGGG + Intronic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137672197 16:50285524-50285546 CTGGTCCAGCGGAGGGAAGATGG - Intronic
1137825306 16:51489643-51489665 CTGGCACAGGGAAAGGAGAGAGG + Intergenic
1139651350 16:68363749-68363771 CTGGGGCTGGGGGAGGAGGATGG - Intronic
1140137049 16:72216052-72216074 ATGGCCCATGGGATGGAGGTGGG + Intergenic
1140859945 16:79009791-79009813 ATGGTACATGGGAAGGAGGAGGG + Intronic
1141622196 16:85242271-85242293 CTGGCAGAGGGGAAGCAGGAGGG - Intergenic
1141635987 16:85314154-85314176 CTGCCTCAGGGGAGGGAGGCTGG - Intergenic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1142110734 16:88329703-88329725 CTGTTCCAGGGGAAAGGGGACGG + Intergenic
1142132501 16:88437401-88437423 CCGGCCCAGGGGTCGGGGGACGG - Exonic
1142160448 16:88554818-88554840 CGGGACCAGCGGAAGGAGTAGGG - Intergenic
1142412444 16:89923485-89923507 CGGGCCCCGGGGCGGGAGGAGGG + Intronic
1203016463 16_KI270728v1_random:356415-356437 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1203034798 16_KI270728v1_random:629573-629595 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1143474316 17:7194080-7194102 CTGGCCCAGAGTATGGAGAAGGG - Intronic
1143517924 17:7429292-7429314 CTGGGCCAGGGATAGGAGAAAGG - Intergenic
1143524328 17:7463394-7463416 CAGGCTCAGGGGGAGGAGGTGGG + Exonic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1143851885 17:9818956-9818978 CAGGCACAGGGCCAGGAGGATGG - Intronic
1143888604 17:10085348-10085370 CAGGCCTAGGGGATGGAGGTGGG - Intronic
1144017005 17:11205830-11205852 CTGCCCAAGGCGAAGGATGAGGG - Intergenic
1144060761 17:11581971-11581993 CTGGCCCAGAGGCCAGAGGAAGG + Intergenic
1144070201 17:11664597-11664619 CTGTCCCTGAGGAAGGAGGATGG - Intronic
1144203350 17:12961101-12961123 CTGGCAGAGAGGATGGAGGAGGG - Intronic
1144582361 17:16466150-16466172 CTGGCTTAGGGGAGGGGGGATGG - Intronic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144711441 17:17404081-17404103 GGGGCCTAGGGGAAGGAGGTGGG + Intergenic
1144717472 17:17444511-17444533 CTGTCCCTGGGAAGGGAGGAAGG - Intergenic
1144762752 17:17716742-17716764 CTGGCCCAGGGCAGGATGGAGGG + Intronic
1144948133 17:18980263-18980285 CTGGCCATGGGGAAGGAGAAAGG - Intronic
1145913167 17:28554271-28554293 CTTGACCAGGGACAGGAGGATGG + Exonic
1145994450 17:29097403-29097425 GGGGCAGAGGGGAAGGAGGATGG + Intronic
1146688486 17:34857138-34857160 CTCACCCAGGAGAAGGTGGATGG + Intergenic
1146984668 17:37203834-37203856 CTGGCCAAGGGCAAGAAGGAAGG + Intronic
1147167015 17:38598906-38598928 CCAGCCCAGGGGATGGAGAAGGG - Intronic
1147313045 17:39606370-39606392 TTGGCCGAGGTCAAGGAGGAAGG - Exonic
1147318815 17:39633781-39633803 CAGGCCTACGGGAAGGAGGCTGG + Intronic
1147323145 17:39657951-39657973 CCTGCCCAGGGGAGGGAGGGAGG - Exonic
1147341704 17:39756323-39756345 CTGGCCCAAGGGATGGTGGAGGG - Intergenic
1147536437 17:41325536-41325558 TTGGCCCTGGGGAAGAGGGATGG - Intergenic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1147657496 17:42098968-42098990 CTGGCGCTGGGGGCGGAGGAGGG - Intergenic
1147899538 17:43774982-43775004 CAGCCCCAGGGGGAGGAAGATGG + Intronic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148213873 17:45824079-45824101 CTGGACTGGGGGAAGGAGGTGGG + Intronic
1148358899 17:46995866-46995888 CCTGCCCAGTGTAAGGAGGAGGG + Intronic
1148360865 17:47010862-47010884 CTGAGCCTCGGGAAGGAGGAAGG - Intronic
1148463260 17:47850159-47850181 CTGCCCCAGGGGCTGGAGGATGG + Intronic
1148564497 17:48625259-48625281 CCGGCCAAGGGGAAGGGGGAGGG - Intronic
1148756408 17:49975376-49975398 CTCACCTTGGGGAAGGAGGAGGG + Intergenic
1148776078 17:50096318-50096340 GTGGCCCTGGGGCAGGAGGGAGG + Intronic
1148860561 17:50602322-50602344 CTGGGGCAGGGCAGGGAGGAAGG - Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1148899553 17:50865987-50866009 CGGGCCCAGGCGGCGGAGGAGGG - Intronic
1148905812 17:50911474-50911496 CGGGGCCAGGGGGAGGGGGAGGG - Intergenic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1149651730 17:58280109-58280131 CAGGCCCACGGGTGGGAGGAAGG + Intronic
1150247794 17:63689264-63689286 CTGGCCAAAGGGAAGGTGTATGG - Intronic
1150285157 17:63950116-63950138 CTGGCCCAGCAGGAGGAGGTGGG - Intronic
1150675525 17:67244199-67244221 CTGGAGCGGGGGAAGGAGGGAGG - Intronic
1150693672 17:67385766-67385788 CGGGCACAGGGAAAGGAGGGCGG + Intronic
1151382298 17:73734316-73734338 CTGGGCTGGGGGAAGGAGGGGGG - Intergenic
1151422811 17:74009655-74009677 GGGGCCCGGAGGAAGGAGGAGGG + Intergenic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1151745625 17:76010257-76010279 AAGGCCCAGGTGGAGGAGGAGGG - Exonic
1151875889 17:76868236-76868258 TTGGCTCAGGGGAAGGAGCAGGG + Intergenic
1151938078 17:77275826-77275848 CTGGTGCGAGGGAAGGAGGAAGG - Intergenic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1151963490 17:77419531-77419553 CCAGCCCTGGGGAAGGGGGAGGG - Intronic
1152247683 17:79193859-79193881 CTGGCCCACAGGAAGGTGGCTGG + Intronic
1152339522 17:79716455-79716477 CTGGCCCTGGGTGAGCAGGACGG + Intergenic
1152340513 17:79721567-79721589 TTGTCCCAGGGATAGGAGGATGG + Intergenic
1152369589 17:79878089-79878111 ATGGTCCGGGGGGAGGAGGATGG + Intergenic
1152373501 17:79905365-79905387 CTGGCTCGGAGGATGGAGGAAGG - Intergenic
1152524312 17:80878958-80878980 CGGGGCCTGGGGAAGGAGGAGGG - Intronic
1152544926 17:80995603-80995625 CTGCCCCAGGGCCGGGAGGAGGG + Intronic
1152618480 17:81348868-81348890 CTAGCCCAGGCCAAGGAGGAGGG - Intergenic
1152635296 17:81428355-81428377 CTGGCACCGGGGGAGCAGGAAGG + Intronic
1152700130 17:81814523-81814545 CGGGTCCAGGCGACGGAGGAGGG + Intergenic
1152742778 17:82025615-82025637 AGAGCCCAGGGGAAGCAGGAAGG + Intronic
1152743650 17:82029496-82029518 CTGGGCCAGGGACAGGAGAACGG + Intronic
1152750537 17:82060565-82060587 CTGCCCAAGGGAAAGGAGGAGGG - Intronic
1152811970 17:82386520-82386542 GCTGCCCAGGGGAAGGCGGAGGG - Intergenic
1152976696 18:228078-228100 GTTGCCCAGGGGCTGGAGGAAGG - Intronic
1155266947 18:24103712-24103734 CTGGGACTGGGGCAGGAGGAGGG - Intronic
1155493303 18:26420407-26420429 CTGTCCCAGCCTAAGGAGGATGG + Intergenic
1156407088 18:36793054-36793076 CTGGCCCTGGTAAAGGAGGAGGG - Intronic
1156450628 18:37264429-37264451 CTGGCCCAGGGGCAGGGGCCTGG - Intronic
1156460299 18:37317998-37318020 TTGGCCAGGGGGCAGGAGGAAGG - Intronic
1156461903 18:37326020-37326042 AAGGACCAGGGGAGGGAGGAAGG - Intronic
1156591230 18:38490945-38490967 GTGGAACAGGGGCAGGAGGAAGG - Intergenic
1156744506 18:40372490-40372512 CTGGCCCAGGAAAGGGAGAATGG - Intergenic
1156944957 18:42817650-42817672 TTGGTCCAGGGGAAGGAGGGAGG + Intronic
1157208116 18:45717847-45717869 GTGGGCCAGGGGAGTGAGGATGG - Intergenic
1157312964 18:46566186-46566208 GGGGCTGAGGGGAAGGAGGAGGG - Intronic
1157335430 18:46734031-46734053 CTGGACCTGGGGATGGTGGAGGG - Intronic
1157564214 18:48668749-48668771 TTGGGCGAGGGGCAGGAGGAAGG - Intronic
1157584204 18:48790892-48790914 ATGGCCCAGCAGAAGGAGAAGGG - Intronic
1157719125 18:49910056-49910078 CTAGACCATGGGAAGCAGGAGGG + Intronic
1158391327 18:57047627-57047649 TTGGCCCAGGGGAAAGAGCGTGG + Intergenic
1160303165 18:77704802-77704824 CAGGGCCACGGGGAGGAGGACGG + Intergenic
1160335976 18:78039996-78040018 CTGGCCTTGAGGATGGAGGAGGG - Intergenic
1160767339 19:814321-814343 CTGGCCCAGGGGTCTGAGGTGGG - Intronic
1160784015 19:891481-891503 CTGGCCCAGGTGAGTGATGATGG + Intronic
1160837496 19:1131723-1131745 CTACCCCAGGGGCAGAAGGAGGG + Intronic
1160959884 19:1715721-1715743 CGGGGCCAGGGGAAGAGGGAGGG + Intergenic
1161091041 19:2360201-2360223 CTGGGCCCGGGGCTGGAGGAAGG - Intergenic
1161166668 19:2791475-2791497 CTGGGCCAGGGGCTGGAGGGAGG + Intronic
1161243276 19:3234831-3234853 CTGGTCCAGGTGAGGGATGAGGG - Intronic
1161335249 19:3709441-3709463 GGGGCAGAGGGGAAGGAGGAAGG + Intronic
1161451814 19:4350497-4350519 CTGGTCCAGGTGAGGGATGATGG + Intronic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1161807322 19:6452230-6452252 CAGCCCCAGGGGAAGGGGAAGGG + Intronic
1162095277 19:8306467-8306489 CTGGGCCAAGGGACAGAGGAAGG + Intronic
1162396437 19:10420406-10420428 CTGGCCCGGACGGAGGAGGAGGG + Intronic
1162424168 19:10583982-10584004 CTGGTACAGCGGGAGGAGGAAGG - Exonic
1162442614 19:10702152-10702174 CTGTCCGAGGTGACGGAGGAGGG + Exonic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1162877303 19:13630188-13630210 CTGTCCCAGGAGGAAGAGGAGGG + Intergenic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163025240 19:14507188-14507210 CTGGCATAGGGGAGGGAGGATGG - Intergenic
1163510686 19:17733345-17733367 CAGGACCAGCGCAAGGAGGAAGG + Exonic
1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG + Intronic
1163632240 19:18423434-18423456 TTGGCAGAGGGGAGGGAGGACGG + Intronic
1163845575 19:19636643-19636665 CTTGGCCAGGGGCTGGAGGATGG + Intronic
1164597575 19:29540211-29540233 CTGGCCCAGGCCAAGGGGCAGGG + Intronic
1164714837 19:30383964-30383986 CTGGCAGAGTGGAAGAAGGAAGG - Intronic
1164816921 19:31211486-31211508 CTGGACCCGGGGAAGAAGGCAGG + Intergenic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1165849234 19:38839725-38839747 CTGTCCCATGGGAAGGCAGAAGG + Intronic
1165922075 19:39305459-39305481 CTGGCGGAGGGCATGGAGGATGG - Intergenic
1165939138 19:39406685-39406707 CTGGCCCAGGGCCGGGCGGAAGG + Intergenic
1165952727 19:39483247-39483269 CCTCCCCAGTGGAAGGAGGAGGG - Intronic
1166198076 19:41219522-41219544 CTGGGGCAGGGGTAGGAGGTGGG + Intronic
1166250841 19:41569950-41569972 CTGGGCCAGGGGGAGGAGCAGGG - Intronic
1166338147 19:42121590-42121612 CTGGTCCAGGGGTAGCAGGCAGG - Intronic
1166359625 19:42247750-42247772 CTGGCCCATGGGCAGGCGGGTGG - Exonic
1166505394 19:43368391-43368413 CTGGCTTAGGGGAAGGCAGAAGG - Intergenic
1166853042 19:45769415-45769437 CAGGCGCAGTGGAAGGAGGATGG + Intergenic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167299546 19:48670948-48670970 CTGGCCCAGGAGGAGCAGGAGGG + Exonic
1167324384 19:48814985-48815007 AAGGCCCATGGGAAGGAGTAGGG + Intronic
1167349856 19:48967894-48967916 CAGACCCAGGGGAAGGAGAAGGG - Intergenic
1167360120 19:49025631-49025653 GTGGCCCGGGGGTAGGTGGAGGG - Intronic
1167360965 19:49030150-49030172 GTGGCCCAGGGGTAGGTGGAGGG + Intronic
1167363450 19:49042542-49042564 GTGGCCCAGGGGTAGGTGGAGGG + Intergenic
1167367291 19:49061530-49061552 GTGGCCCGGGGGCAGGTGGAGGG - Exonic
1167485590 19:49761273-49761295 CTGGCCCAGGGGAAGCCAGGTGG + Intronic
1167591485 19:50406775-50406797 CAGGGCCAGAGGGAGGAGGAGGG - Intronic
1167600267 19:50450947-50450969 CAGCCCCCAGGGAAGGAGGAAGG - Intronic
1168164235 19:54535729-54535751 CTTGACCAGGGGATGGAGGCTGG + Exonic
1168288524 19:55346165-55346187 CTGGCCCAGGGCACAGGGGAGGG - Intronic
925285284 2:2711794-2711816 GTGGCCCAGGAGATGCAGGAAGG + Intergenic
925313960 2:2907205-2907227 CTGGAAGAGGGGATGGAGGAAGG - Intergenic
925406180 2:3606591-3606613 CTGTCCCAGAGCAAGGAGCAGGG - Intronic
925665110 2:6245109-6245131 ATGGCCCAGGAGACAGAGGAGGG - Intergenic
925924266 2:8659188-8659210 CTGCCCCAGGGGCAGGGGCAGGG + Intergenic
926126680 2:10276648-10276670 CTGGCCCAGGGGTGGGTGGAGGG - Intergenic
926148571 2:10411824-10411846 CTTGCTCAGGGCAAGGAGGTAGG + Intronic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927096282 2:19749944-19749966 CTGGCCCAGCTGCAGGAGGCTGG - Intergenic
927177672 2:20421963-20421985 CTGGGCCTGGGGATGGTGGAGGG - Intergenic
927853174 2:26512622-26512644 CTGGCCCAGGGGCAGGTATAGGG - Intronic
928094849 2:28398296-28398318 CTGGCCCAGGGAGTGGAGAAGGG - Intronic
928166633 2:28977055-28977077 CTGGCCCAGGCTGAGGAGAAAGG - Intronic
928241162 2:29587872-29587894 CTGGTTCAGGGGAAAGAGGTGGG + Intronic
928317021 2:30254626-30254648 CAGGCCCAGCAAAAGGAGGAGGG - Intronic
928607167 2:32953627-32953649 CAGGCCCATGGGCCGGAGGAGGG - Intronic
929029147 2:37634769-37634791 CAAGCACAGGAGAAGGAGGATGG + Intergenic
929047479 2:37804131-37804153 TGGGGTCAGGGGAAGGAGGAAGG - Intergenic
929578488 2:43067659-43067681 CTGGCCCAGGTGTTGGGGGAGGG - Intergenic
929584459 2:43105128-43105150 CTAGCCCAGGGGTTGGAGGCTGG - Intergenic
929584900 2:43107400-43107422 CCGGCCCAGGGGATGATGGATGG - Intergenic
929958757 2:46480382-46480404 CTGGCGTAGGGGAAGCAGGGAGG - Intronic
930742653 2:54847577-54847599 CTGGCCCTGGGCATGAAGGACGG + Exonic
930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG + Intronic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931459842 2:62441104-62441126 CTGTCCCAGGAGGAGAAGGATGG + Intergenic
932220792 2:69997509-69997531 TTTGCACAGGGGAGGGAGGAAGG - Intergenic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932610015 2:73191944-73191966 CAGGTGCAGGGGAAGCAGGAGGG + Intergenic
932752532 2:74380367-74380389 CTGGCCCACGTGAAGCAGGGGGG - Intronic
933032428 2:77346974-77346996 CTGTCCCAGGGCAGGGAAGAGGG - Intronic
933566330 2:83954898-83954920 GTGGCACAGGGGTAGGAGGTGGG - Intergenic
933877017 2:86630129-86630151 CTAGCCCAGTGGAAGGTGGGAGG - Intronic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934091007 2:88550217-88550239 GTTGCCCAGGGGGTGGAGGAGGG - Intergenic
934157215 2:89214577-89214599 CTGGCCCAGCTGAAAGAGGTAGG - Intergenic
934187759 2:89762279-89762301 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
934210099 2:89968167-89968189 CTGGCCCAGCTGAAAGAGGTAGG + Intergenic
934308858 2:91845669-91845691 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
934736285 2:96691448-96691470 CTGGCCAAGGGCGAGGAGGAGGG + Intergenic
934882553 2:97996144-97996166 CTGGCGCAGGAGAAGGAGGGAGG + Intergenic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
935580333 2:104750660-104750682 CAGGACCAGGGGCAGGAGCAAGG + Intergenic
935656288 2:105426528-105426550 CTGGCTCAGGGAAGGGAGGAGGG - Intronic
935949315 2:108314478-108314500 CTGTCTCAGGGCAAGAAGGAAGG + Intergenic
936059354 2:109284161-109284183 CGGTCCCAGGGGAAGGGGGTTGG + Intronic
936107858 2:109640821-109640843 CAGGCCCAGGTGTAGCAGGAAGG + Intergenic
936228292 2:110678171-110678193 CTGGCTCAAGGGAGGGAGGTGGG - Intergenic
936373178 2:111919834-111919856 TTGGGCCAGGGGCAGTAGGAAGG + Intronic
936773735 2:115947040-115947062 CTGGCTCTGGGGAACAAGGAGGG + Intergenic
937100217 2:119262955-119262977 CTGGCGGAGGGGAAGGAGGGTGG - Intronic
937927237 2:127176695-127176717 CTGGCCCATGGGAAGAACGTTGG - Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
937987112 2:127642853-127642875 CTGGCCCAGGGTAAGGGCGGTGG - Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938966351 2:136392074-136392096 CTGGGGCAGGGGAAGCAGGGAGG - Intergenic
939059335 2:137400849-137400871 CTGGAGCAGGGGAAGAAGGTAGG + Intronic
940214228 2:151288380-151288402 CTGGCCCTGAAGATGGAGGAAGG + Intronic
941777199 2:169406057-169406079 CTGGCACAGTGGAAAGAGCAAGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942075404 2:172352690-172352712 CTGAGCCAGGGGAAGAAGAAAGG + Intergenic
942117591 2:172743362-172743384 CTGGGGCAGGGGAAGCAAGAGGG - Intronic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
944848712 2:203695111-203695133 AGGCCCCAGGGGAAAGAGGAGGG + Intergenic
945656287 2:212628012-212628034 ATGACCTAGGGGAAGTAGGAAGG + Intergenic
946114036 2:217446069-217446091 CTGGCCTAGGGGCAAGGGGATGG + Intronic
946155542 2:217804435-217804457 CTGGCCCTGGGCAAGGGGCAGGG + Exonic
946182902 2:217959749-217959771 CTGGCCCAAGGGAAGCAGCTGGG + Intronic
946190668 2:218006190-218006212 CTGGCCCTGGGGCTGGAGGAGGG + Intergenic
946422844 2:219574729-219574751 CTGGCCCAGGAGGCTGAGGAGGG + Exonic
946732727 2:222724737-222724759 CAGTCCCAGGGAAAGTAGGATGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947441649 2:230127247-230127269 CCTGCCCTGGGAAAGGAGGATGG - Intergenic
947797102 2:232901593-232901615 CTGGCCGTGAGGAAGGTGGAGGG - Intronic
947823484 2:233088777-233088799 CAGGCACAGGGGAAGGAGAAAGG + Intronic
948568948 2:238905282-238905304 CTGGCCCAGGAGTCGGGGGATGG - Intronic
948662593 2:239516332-239516354 CTGGCCCTGGTGATGGAGGCAGG + Intergenic
948673414 2:239583307-239583329 CAGGTCCAGGGGAAGGTGCAGGG - Exonic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
949003015 2:241628200-241628222 CGGGTCCAGGGGAAGGCTGAGGG - Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168904084 20:1390339-1390361 CTGGCCATGGGGAGGGGGGAGGG + Intronic
1169069230 20:2712279-2712301 ATAGCCCAGGTGAAGGATGATGG + Intronic
1169227710 20:3866473-3866495 TTGGCCCAGGTGGAGCAGGAGGG + Exonic
1169800455 20:9507595-9507617 CTGGACCAGGGGAGAGAGGCCGG + Intergenic
1170370341 20:15640972-15640994 CTGGCCCAAGGAAATGAGGAAGG - Intronic
1170500203 20:16967977-16967999 CCACCCGAGGGGAAGGAGGAAGG - Intergenic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1170923611 20:20702408-20702430 CTGACCCCTGGGAAGGAGAAGGG + Intronic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1171400924 20:24872661-24872683 CATCCCCAGGGGAAGGGGGAGGG + Intergenic
1171964062 20:31515989-31516011 CTGCTCCTGGGGAAGGAAGATGG - Intronic
1172008844 20:31834601-31834623 CAGGCCCAGGAGAATTAGGAAGG + Exonic
1172118181 20:32583835-32583857 CCGGCCCGGGGGACGGGGGAGGG + Intronic
1172199180 20:33113261-33113283 GTGGCCCAGGGGAGAGATGATGG - Intergenic
1172501846 20:35433270-35433292 CTGACCCAGGGCAGGGAGGTGGG - Intronic
1173167710 20:40697642-40697664 CTGGCACAGGGCCAGGAGGGGGG - Intergenic
1173458916 20:43226037-43226059 TTGGCCCAGGGCAAGAAGGATGG + Intergenic
1173568413 20:44058650-44058672 CTGGTCCAGTGGAAGTAGCAGGG - Intronic
1173898930 20:46572535-46572557 CTGGCCTAGAGGAAGGAGGCTGG - Intronic
1173959196 20:47058105-47058127 TTGGCCCAGGAAAAGGAGGAAGG + Intronic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174387244 20:50194402-50194424 CTGGACCTAGGGAAGGAGGGAGG + Intergenic
1174543619 20:51308496-51308518 CAGGTCCAGGGGAGGGAAGAAGG + Intergenic
1174548357 20:51343422-51343444 CTGGAGCAGGGTGAGGAGGAAGG + Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175038741 20:56025480-56025502 TTGGCCCTGGGCAAAGAGGAGGG - Intergenic
1175440822 20:58989915-58989937 CTGGCCCAGGAGGAGCAGGGGGG + Exonic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1176171362 20:63697779-63697801 CTGCCCGAGGGGAAGGTGGCTGG + Intronic
1178332351 21:31709292-31709314 TTTTCCCAGGGGAAGGAGAAGGG - Intronic
1178662627 21:34520356-34520378 CTGGCCCGGGGGCATGAGCATGG - Intronic
1178797468 21:35758118-35758140 ATGACCCTGGGGAAGGAGGGAGG - Intronic
1179046636 21:37850562-37850584 ACGGACCAGGGGCAGGAGGAGGG - Intronic
1179091351 21:38268877-38268899 CTGGTCCTGGGGAAGAAGGAAGG - Intronic
1179400261 21:41076575-41076597 GTGGGCCAGAGGAAGGAAGAGGG - Intergenic
1179409781 21:41153798-41153820 CTGGGCCAAGGCAGGGAGGAAGG + Intergenic
1179540617 21:42081245-42081267 GAGGCCCCGAGGAAGGAGGAGGG + Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179786771 21:43734682-43734704 CTGGCTCAGGGGACTGAGGGTGG + Intronic
1179802819 21:43819490-43819512 CAGTCCCAGGGGAGAGAGGAGGG + Intergenic
1180042508 21:45287606-45287628 CAGGCCCACGGGATGGAGGGTGG - Intronic
1180149682 21:45941158-45941180 CAGGCCCATGGGCAGGAGGCTGG + Intronic
1180535941 22:16392757-16392779 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1181078722 22:20400052-20400074 CAGGCCCAGGGGGAGCAGGCAGG + Intronic
1181439257 22:22927384-22927406 CTGGGGCCGGGGAAGGAGCAAGG - Intergenic
1182287258 22:29255732-29255754 CTGGCCCAGAGGAGGTTGGAGGG + Intronic
1182473294 22:30561628-30561650 CAAGCCCAGGGGAAGGAAGGAGG + Intronic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1182573142 22:31254173-31254195 CAGGCCCAGGAGAGGGAGCAGGG - Intronic
1182692768 22:32175586-32175608 CTGGACCAGGGCTAGGAGAAAGG - Intergenic
1182753597 22:32660773-32660795 CTGGCCCAGAGCAAGGATTAAGG + Intronic
1182764399 22:32748275-32748297 GTGGCCCAGGAGAAAGAGCATGG + Intronic
1182883414 22:33753348-33753370 CTGGCCTTGGGGATGGAGGAAGG + Intronic
1183063775 22:35350230-35350252 GTGGCCCAGGGGAGCCAGGAGGG - Intergenic
1183100936 22:35583614-35583636 CTGGCCTGGGACAAGGAGGAGGG + Intergenic
1183272091 22:36868619-36868641 CTAGCCCAGGGGGAGAAGGGTGG - Intronic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183704045 22:39466081-39466103 CAGGCCCAGGGGTGGCAGGATGG + Intronic
1183900582 22:41002997-41003019 CTGAGCCAGGGTTAGGAGGAAGG - Intergenic
1184143943 22:42597276-42597298 CTGACCCAGGGCAGGGAGAAAGG + Intronic
1184275944 22:43409900-43409922 CTGGCCCAGGGGAGGCATGAGGG + Intergenic
1184323357 22:43761134-43761156 CTTGCAGAGTGGAAGGAGGAAGG - Intronic
1184341158 22:43886633-43886655 CAGGGCCAGGGGAAGGCAGAAGG - Intronic
1184403412 22:44286719-44286741 CTGGCCCTGGGGAAGGGTGTGGG - Intronic
1184491065 22:44809372-44809394 CTGGACCAGGGGTGGGAGAATGG - Intronic
1184533360 22:45070768-45070790 CTGGCCCAGGGTGAGGGGTAGGG - Intergenic
1184549740 22:45198127-45198149 CTGGGCCAGAGGAAGCAGGGAGG - Intronic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1184785445 22:46669373-46669395 CTGGCGGCGGGGAAGGAGGGTGG + Intronic
1184853771 22:47135584-47135606 ATGGCCCAAGGCAAGGATGAGGG + Intronic
1184917936 22:47585979-47586001 CACTCCCAGGGGAAGGAGGCTGG - Intergenic
1185004556 22:48268061-48268083 CCGGCCATGAGGAAGGAGGAGGG + Intergenic
1185149803 22:49157756-49157778 GTGGCCCTGGGCACGGAGGAGGG + Intergenic
1185227212 22:49659944-49659966 CTGGCCCAGAAGTAGGACGAGGG + Intergenic
1185231566 22:49686932-49686954 CTGCTCCATGGGCAGGAGGAGGG - Intergenic
1185338900 22:50282991-50283013 CTGGCCCTGGGTATGGAGGGGGG - Intronic
1185414453 22:50702150-50702172 CTGGACCAGTGGATGGAGGGAGG - Intergenic
1185422031 22:50740118-50740140 CTGGCACAGGGGACTGTGGAAGG - Intronic
949294629 3:2507182-2507204 CTGGCCCAAGGGAAGCATGATGG - Intronic
950221916 3:11202553-11202575 CTTGGCTAGGGGATGGAGGAGGG - Intronic
950266675 3:11578413-11578435 CTGGACCATGGGAAGGCGGCTGG - Intronic
950458086 3:13104567-13104589 CGTGCACAGGGGAAAGAGGATGG - Intergenic
950467075 3:13161985-13162007 CCAGCCCTGGGGGAGGAGGATGG - Intergenic
950572390 3:13809467-13809489 ATGGCAGAGGGGAAGGAGGTGGG + Intergenic
950648303 3:14391628-14391650 CTGGCCCACGGGAAGGAGCAGGG + Intergenic
951553263 3:23896227-23896249 CTTGTCCGGGTGAAGGAGGATGG - Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952684631 3:36133792-36133814 CTGGCACAGGAGAAAGATGAAGG + Intergenic
952948362 3:38496545-38496567 CTGGGCCAGCGAAGGGAGGACGG - Intronic
952979044 3:38720599-38720621 CAGTCCCAGGGGAAGGAGATGGG + Intronic
953003181 3:38953246-38953268 GAGGCCCATGGGAAGGTGGAGGG + Intergenic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
953626761 3:44578504-44578526 CTGGCCCAGGCGCTGGAGGCCGG - Intronic
953902334 3:46850310-46850332 CTAGCCCCGGGAAAGGTGGATGG - Intergenic
953956667 3:47236742-47236764 CTGGCCCATGGCAAGGAGATGGG + Intronic
953979418 3:47406244-47406266 CTGCCCCTGGGGAAGGATAAAGG + Intronic
954299428 3:49691529-49691551 CTGGCCCAGCAGAGTGAGGAGGG - Intronic
954379352 3:50211319-50211341 TTGGTCCAGGGCAGGGAGGAGGG - Intronic
954391024 3:50267947-50267969 CTGACCCCTGGGAAGGAGGGTGG + Intronic
954420700 3:50417609-50417631 CAGGCCCAGAGCCAGGAGGAAGG + Intronic
954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG + Intronic
954596513 3:51829934-51829956 AAGGCCCAGGAGAATGAGGAGGG + Intronic
954623078 3:52006660-52006682 CTGGCCCTGGGGTATGAAGATGG - Intergenic
954712109 3:52510265-52510287 CTGACCCAGAGGCAGGAGGTGGG + Intronic
954794795 3:53155997-53156019 CTGTCCCAGGGCAAGGATTAGGG + Intronic
954879241 3:53822686-53822708 CTGGCACCTGGGCAGGAGGAAGG + Intronic
956738701 3:72258641-72258663 CAGACCCAAAGGAAGGAGGAGGG + Intergenic
957193357 3:77039103-77039125 CATCCCCAAGGGAAGGAGGAAGG - Intronic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
958594159 3:96200848-96200870 CAGGCCCAGGGCAAGGAAGCTGG - Intergenic
959009686 3:101060945-101060967 CTGCCCCAGGGGAGGTAGCAGGG + Intergenic
959421693 3:106136206-106136228 CTGGCACATGTGAACGAGGACGG + Intergenic
959498588 3:107079168-107079190 CTGGGGCAGAGGAAGGAGGCAGG + Intergenic
960235863 3:115281296-115281318 TTGGAACAGGGAAAGGAGGATGG - Intergenic
960955711 3:123029035-123029057 ATGGTCCAGGGGTAGGAGGATGG - Intergenic
961424275 3:126832762-126832784 CTGACCCAGAGAAAGGGGGAGGG + Intronic
961445499 3:126979122-126979144 CTGCCCCAGGGGCAGGAGCATGG + Intergenic
961460160 3:127045119-127045141 CTGGCTCAGGTGCAGGTGGAGGG + Intergenic
961476494 3:127150076-127150098 CTTGCCCAGGGGCAGGAGGGTGG + Intergenic
961816991 3:129556174-129556196 CTGGGGCGGGGGCAGGAGGAGGG - Exonic
962263686 3:133930781-133930803 CTGGCCCATGGGAGGGAAGTGGG - Intergenic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
963858110 3:150277392-150277414 CTGACCCTGGGGAAGGAAGCAGG - Intergenic
964036542 3:152206096-152206118 CTGGGCCTGGGGGAAGAGGAGGG - Intergenic
964555717 3:157936020-157936042 CTGCCAGAGGTGAAGGAGGAGGG + Intergenic
965318828 3:167226013-167226035 CTGGACCAAGGGAATGAGTATGG - Intergenic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
966936269 3:184711760-184711782 CAGGCCGAGGGGGAGAAGGATGG - Exonic
967035739 3:185647223-185647245 GTGGAGCAGGGGAAGGAGGGGGG + Intronic
967078257 3:186024811-186024833 ATGGCCCGAGGGAAGGAGGATGG + Intergenic
967214429 3:187198583-187198605 CTGAACCAGGGCAAGCAGGAAGG - Intronic
967268634 3:187714521-187714543 CTGGCTCCAGGGAAGCAGGAAGG - Intronic
967279162 3:187805648-187805670 CTGGCTTGGGGGATGGAGGAAGG + Intergenic
967403864 3:189094865-189094887 CTCGACCAGAGCAAGGAGGAAGG - Intronic
968007002 3:195249936-195249958 CTGGCTCTGGGGAGAGAGGATGG - Intronic
968047454 3:195632054-195632076 CTGACCCAGGGGCAGGAGGTGGG + Intergenic
968188933 3:196653454-196653476 CTGGCCCAGGAGAAGATGGGAGG + Intronic
968236201 3:197031129-197031151 CTGGATCAGGGGAAGGAACATGG + Intergenic
968307159 3:197657870-197657892 CTGACCCAGGGGCAGGAGGTGGG - Intergenic
968624736 4:1622036-1622058 AGGGCAGAGGGGAAGGAGGAAGG - Intronic
968625812 4:1626200-1626222 TTGGCCCAGGAGGAGGAGGTAGG + Intronic
968654890 4:1774151-1774173 CTGGCTCATGGGAAGGATGGGGG + Intergenic
968810545 4:2797784-2797806 CTGTCCCAGAGGAAGGGTGAGGG + Intronic
968914011 4:3489315-3489337 CCGGCCCTGGGGATGGGGGAGGG + Intronic
968944433 4:3656006-3656028 CTGGCACAGGGTCAGGAGCATGG - Intergenic
968993934 4:3933533-3933555 CTGGCCTAGGGGTAGAAGCAGGG - Intergenic
969121324 4:4913492-4913514 CAGGCCCTGGGGAAGGGGGAGGG + Intergenic
969283802 4:6190002-6190024 CAGGCCCAGGGGCAGGGGAATGG - Intronic
969302351 4:6304545-6304567 GTGGCCCAGGGGAAGGGGACAGG - Intergenic
969308370 4:6338408-6338430 CTGGCTCAGGCCAAGGTGGAGGG + Intronic
969315206 4:6377724-6377746 GGGGCCCAGGTGAAGGAGGATGG + Intronic
969457159 4:7306650-7306672 CTGGTCCTGGGGAAGGAGGGTGG + Intronic
969458969 4:7317571-7317593 CAGGCCCATGGGGAAGAGGAAGG - Intronic
969572901 4:8020431-8020453 CCTGCCCAGGGGAAGGAGTGTGG + Intronic
969598500 4:8162097-8162119 CCGGCCCAGGGCCAGCAGGAAGG + Intergenic
971019173 4:22516484-22516506 CTGGCCCGGAGGATGGAGTAGGG + Intergenic
971263088 4:25074904-25074926 CTGGCCCAGGGACAGGATGACGG + Intergenic
972381487 4:38524278-38524300 CTGGCGCAGGGAAAGGAAGAAGG - Intergenic
973262306 4:48177541-48177563 ATGGCCCAGGTGAATGAGGCAGG - Intronic
975610457 4:76197487-76197509 CTGGCTCAGTGGAACGAGGCTGG - Intronic
976226180 4:82797461-82797483 GGGGCCCAGGGGAAGGGGAATGG + Intronic
976376657 4:84353124-84353146 CTGGCACAGGGCAAGGGAGAAGG - Intergenic
976462663 4:85330578-85330600 TTGGCCCAGTGAAAGAAGGAAGG + Intergenic
976823176 4:89230374-89230396 CTGACACAGGTGAAGAAGGAAGG - Intergenic
978649530 4:110983903-110983925 CTGGCTCTGGGGAAAGAAGATGG - Intergenic
981029071 4:140105799-140105821 CTGGCCCAGGATAAGGATGCTGG + Intronic
981038327 4:140195381-140195403 CTGTACCAGGGACAGGAGGAGGG + Intergenic
981724699 4:147834797-147834819 CTGACCCAGGGGAAGGAGACAGG - Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982783569 4:159516526-159516548 CAGTCTCATGGGAAGGAGGAAGG + Intergenic
982846045 4:160253787-160253809 GTGACCCAAGGGAAAGAGGATGG - Intergenic
984288250 4:177761291-177761313 GGGGCCCAAGGGAATGAGGAGGG + Intronic
984908167 4:184649068-184649090 CTGGCCCGGGGGCGGGAGGCTGG - Intronic
985010165 4:185573913-185573935 CTGGGCCAGAGGCTGGAGGAAGG + Intergenic
985221574 4:187711587-187711609 CTGGCACAGAGAATGGAGGAGGG + Intergenic
985489542 5:171334-171356 CTGGCCCAGGGGCAGGAGCTGGG + Exonic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985531883 5:438657-438679 CAAGCCCATGGGAAGGGGGAAGG + Intergenic
985708418 5:1414662-1414684 CAGGCCCAGGTGCAGCAGGAGGG + Intronic
985744155 5:1637110-1637132 CTGACGCAGGGGCAGGAGGTGGG - Intergenic
985774554 5:1833990-1834012 CTGGCCCAGGGCAGAGAAGAGGG - Intergenic
986287852 5:6373222-6373244 CTGGCCGAGTGGGAGGAGCAAGG - Intronic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986681001 5:10232748-10232770 ATGGCCCAGGGGAGGCTGGAGGG + Intronic
986773496 5:10994333-10994355 CGGGGGCCGGGGAAGGAGGAGGG + Intronic
987114225 5:14713716-14713738 CTGGTCCAGAGGCAGCAGGATGG - Intronic
987183018 5:15386252-15386274 CCAGCTCTGGGGAAGGAGGAGGG - Intergenic
987183051 5:15386369-15386391 CTGACCCAGGGCTAGGAGTAGGG + Intergenic
987958104 5:24766130-24766152 CTGGGCTAGGGGAGGGGGGAGGG + Intergenic
988609311 5:32710577-32710599 GTGGCCCAGGGGGAGGGGGCTGG + Intronic
988728911 5:33950687-33950709 ATGGCCCAGGTGAAGGAAGTGGG - Intronic
989466412 5:41760915-41760937 CTTTCCCAGGGGAAGCAGGTGGG + Intronic
992079120 5:73217349-73217371 ATGGCCCAGGAAAAGGAGGAGGG + Intergenic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
994123612 5:96145859-96145881 CTGGCCCAGGGCATGTAAGATGG + Intergenic
995544454 5:113216000-113216022 CTGGAACAGGGAAAGGAGAAGGG - Intronic
995840413 5:116438517-116438539 CTGCCCCAAGGGCAGGAGGAAGG + Intergenic
996765609 5:127031468-127031490 CTTGCGAAGGGGAAGGAGGGCGG - Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
997739641 5:136242375-136242397 CTGGCCTAAGGGGAGGAGCATGG - Intronic
997739742 5:136243134-136243156 CTGTCCCAAGGGGAAGAGGAAGG - Intronic
999182671 5:149681109-149681131 GTGGAGCAGGGGAGGGAGGAGGG - Intergenic
999624069 5:153501710-153501732 CTGGCAGATGGGCAGGAGGATGG + Intronic
999777624 5:154823593-154823615 CTGCCCAAGGGAAGGGAGGAGGG + Intronic
999829533 5:155305623-155305645 GATGCCCAGGGGAAGGAGGGGGG - Intergenic
1000052672 5:157575856-157575878 CTCCGCCAGGGGATGGAGGAGGG + Intergenic
1000064515 5:157683351-157683373 CTGGCCCATGGGAAGAAGTATGG - Intergenic
1000082524 5:157861428-157861450 CAGGCCCAGGGGAGGGAAGGTGG - Intergenic
1001124272 5:169005432-169005454 CTGGCCCATGGCAAGGTGAACGG + Intronic
1001191535 5:169637169-169637191 CTGCCCAACGGGAGGGAGGAGGG + Intergenic
1001193642 5:169652714-169652736 TTGGACCAGGGGAAGGAGGAAGG + Intronic
1001219597 5:169888848-169888870 CTATCCCAAGGGAAAGAGGAGGG - Intronic
1001565936 5:172699573-172699595 CTGGCCCCTGGCAATGAGGATGG - Intergenic
1001654678 5:173340452-173340474 AAGGGCCAGGGGAAGGAGTATGG + Intergenic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1002211974 5:177604617-177604639 CTGGGGCAGGGGCAGGAGGGCGG + Intronic
1002351763 5:178588947-178588969 CTATCCCAGGAGAAGGAGGAAGG + Intronic
1002702887 5:181138419-181138441 CCGGCCTAGGGGAAGGAGACGGG - Intergenic
1002763428 6:218922-218944 CTGGCCTCGGGGACAGAGGATGG - Intergenic
1003293812 6:4805999-4806021 CTGGCGCAGGAGCATGAGGAAGG + Intronic
1003624245 6:7727673-7727695 CGGGCCCAGGGGATGGAGTGAGG + Intronic
1003982604 6:11403558-11403580 CTGGACCCTGGGAAGCAGGAGGG + Intergenic
1004380527 6:15128553-15128575 CTAGCCCAGGGGGAGAATGAGGG - Intergenic
1005520476 6:26596826-26596848 CGGGTCCAGGGGAAGGCCGAGGG - Intergenic
1005777110 6:29146238-29146260 CTGGGGCAGGGGAAGGAAGGGGG - Intergenic
1006077380 6:31542440-31542462 CTAGCTGAGGGGAGGGAGGAGGG + Exonic
1006185707 6:32180546-32180568 TCTGCCCTGGGGAAGGAGGATGG + Exonic
1006359375 6:33578911-33578933 CAGGCCTAGCGGAAGGAGGGTGG - Intronic
1006457539 6:34140591-34140613 CTGGCTCTGGGAGAGGAGGAAGG - Intronic
1006696004 6:35931379-35931401 CTGGCCCCGGACAATGAGGAGGG + Intergenic
1006727275 6:36208745-36208767 CTGGTCCTGGGGAAGTAGGCAGG + Intronic
1007103476 6:39267583-39267605 AGGGCTCATGGGAAGGAGGAGGG - Intergenic
1007365180 6:41386389-41386411 CTGGCCCAGGGGAAGGGCTGAGG + Intergenic
1007483781 6:42166879-42166901 GGGGCCGAGGGGAGGGAGGATGG - Intronic
1007705098 6:43785679-43785701 AAGGACCAGGGGATGGAGGAAGG - Exonic
1007836978 6:44681531-44681553 CTGGCAGAGGGGAAAGAAGAGGG + Intergenic
1008367532 6:50699724-50699746 TAAGCCCAGGGGAAGGAGGAGGG - Intergenic
1008688157 6:53946475-53946497 CTGGCACATGGAAACGAGGATGG + Intronic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1010032752 6:71288366-71288388 CTGGACCAGGGAGAGGGGGAGGG + Intergenic
1012371626 6:98514176-98514198 GTGGGCCAGGGAAAGGAGTAGGG - Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013268217 6:108521093-108521115 ATGGACCAGGGGCAGGGGGATGG - Intronic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1013456544 6:110334586-110334608 CAGGCCCAGGGGTTGGGGGATGG + Intronic
1013589172 6:111605842-111605864 CTGGGCCCGGAGAAGGTGGAGGG - Exonic
1014002538 6:116380937-116380959 CTGGCTAAGGTGAAGAAGGAAGG - Intronic
1015153086 6:130060831-130060853 CTGGCTCAAGGGAGGGAGCAAGG - Intronic
1015500173 6:133923425-133923447 CTGACCCAGGGTAAGAAGCAAGG - Intergenic
1015744183 6:136492088-136492110 CTGGGCCAGGGGCAGGGGGTGGG + Intronic
1016710647 6:147167657-147167679 TTGGCACAGTGGAAGTAGGAAGG - Intergenic
1016932233 6:149422750-149422772 CAGGCCCAGGGGAGCCAGGACGG - Intergenic
1016985356 6:149890772-149890794 CTGGCTGAGGACAAGGAGGAGGG - Intronic
1016990709 6:149925947-149925969 CAGCCCCAGGGCGAGGAGGATGG - Intergenic
1016992287 6:149938528-149938550 CAGCCCCAGGGCAAGGAGGATGG + Intergenic
1016994842 6:149954467-149954489 CGGCCCCAGGGCAAGGAGGATGG + Intergenic
1017003763 6:150014969-150014991 CGGCCCCAGGGCAAGGAGGATGG - Intergenic
1017007436 6:150038084-150038106 CATCCCCAGGGCAAGGAGGATGG - Intergenic
1017071131 6:150576411-150576433 CTGGCGTATGGGAAGGAGGAAGG + Intergenic
1017529975 6:155280244-155280266 CTGGCCCAGTGGAAGGAGCTTGG - Intronic
1017722416 6:157253194-157253216 CTGGCATAGGTGCAGGAGGATGG - Intergenic
1017891692 6:158644572-158644594 CTGGCCTAGCTGAAGGAGGTGGG + Intronic
1018903081 6:168060796-168060818 CTGGTCCTGGGGCTGGAGGACGG + Exonic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1019190938 6:170250258-170250280 CAGGCCCAGAGGCAGGAGGGTGG - Intergenic
1019261354 7:83765-83787 CTGGCCCTGTGGAAGGAACATGG - Intergenic
1019360639 7:602591-602613 CTGGCGCTGGGGCAGGAGGGTGG + Intronic
1019519157 7:1452887-1452909 CCGGCCCTGGGGAAGGAGCTTGG - Intronic
1019549163 7:1593703-1593725 CTGGCCAAGGGGAAGGAAGGAGG + Intergenic
1019643269 7:2115893-2115915 GTGGGCCTGGGGCAGGAGGAAGG - Intronic
1019701364 7:2476337-2476359 CTGGACCTGGAGAAGGAGAACGG - Intronic
1019919794 7:4156229-4156251 GTGGCGCAGGGGGAGGAGGCAGG + Intronic
1020073282 7:5241348-5241370 ATGTCCCCGGGGAAGGAGGGTGG + Intergenic
1021320477 7:19204179-19204201 CTGGCTATGGGGAAGGAGGTGGG - Intergenic
1021927358 7:25546244-25546266 CTATGCCAGGGCAAGGAGGAGGG + Intergenic
1022216930 7:28272551-28272573 CTCCCCCAGAGGAAGGAGGAAGG - Intergenic
1022223003 7:28332594-28332616 CTGGCCCAGGAGAAGGTTGCTGG - Intronic
1024013173 7:45287956-45287978 CTGGCCTCTGGGAAGGAGGAGGG - Intergenic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1024713115 7:52040242-52040264 CTCCACCAGGGGAATGAGGAGGG - Intergenic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1025078472 7:55963324-55963346 CAGTCCCAGGGGAAGAAGGGAGG - Intronic
1025300823 7:57818740-57818762 CTGGCCCTGGGGAAGGGGTTGGG + Intergenic
1025769926 7:64495079-64495101 AGAGTCCAGGGGAAGGAGGAGGG - Intergenic
1025875348 7:65476302-65476324 TTCGGCCAGGGGAAGGAGCAGGG - Intergenic
1026085698 7:67261268-67261290 CTGGCATATAGGAAGGAGGAAGG - Intergenic
1026582632 7:71630999-71631021 CTGGCCCTGGGAATGCAGGAAGG + Intronic
1026600522 7:71773759-71773781 GAGAACCAGGGGAAGGAGGATGG + Intergenic
1026879988 7:73901932-73901954 CTGGCACTGGGGGAGAAGGAGGG - Intergenic
1027144018 7:75681432-75681454 CTGGTCTAGGGGCAGCAGGAAGG - Intronic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1029257229 7:99277756-99277778 CTGGACCCTGGGAGGGAGGAAGG + Intergenic
1029337769 7:99916929-99916951 ATGGAGCATGGGAAGGAGGATGG - Intronic
1029409798 7:100401679-100401701 TTGGCCCAGGGGCAGGAGAATGG - Intronic
1030173440 7:106627632-106627654 CTGGCACCAGGGAAGAAGGAGGG + Intergenic
1030661412 7:112223284-112223306 CTGGCCCAGGGGACTCAGAATGG + Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031627752 7:124009802-124009824 CTGGCCCATGGGAAGGAAGAGGG + Intergenic
1031796842 7:126185922-126185944 CTGCCCCAGTGGAAGTAGCAGGG + Intergenic
1031857333 7:126938200-126938222 CTGGCCCATGGGAAGGGGGAAGG - Intronic
1032086433 7:128886379-128886401 CTGGCTGAGGGGAGGGAGGTGGG + Intronic
1032474982 7:132205439-132205461 CTGCCCCAGTGGAGGGAGAAGGG + Intronic
1033348385 7:140542507-140542529 CTGGCCCAGAGAGAGGAAGATGG - Intronic
1033558373 7:142508360-142508382 CTGGCCCAGGGCAAAGAAAATGG - Intergenic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1034329391 7:150269508-150269530 CCGGCCCAGGGAAGGCAGGACGG + Intronic
1034668665 7:152840353-152840375 CCGGCCCAGGGAAGGCAGGACGG - Intronic
1034715611 7:153238621-153238643 CTGGCCCAGATTCAGGAGGAGGG + Intergenic
1034881125 7:154763477-154763499 CTAGCTCAGGGGTAGGAAGAGGG - Intronic
1035055264 7:156031074-156031096 CTGGCCCAGTGGAAGCTGGAAGG - Intergenic
1035327867 7:158076468-158076490 TTGGCCCCGGGGGAGGGGGAGGG - Intronic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035640990 8:1185015-1185037 CTGACCCGGGGGACGGGGGATGG + Intergenic
1035811469 8:2495190-2495212 CTGCCCAAAGGGAAGGACGAGGG - Intergenic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1036755627 8:11468931-11468953 GTGGGCCAGAGGAAAGAGGAAGG + Intronic
1037817684 8:22120609-22120631 GTGGCTCAGGGGGAGCAGGAGGG - Intronic
1037882916 8:22581598-22581620 CTAGCCCATGGGCAGGAGCAAGG - Intronic
1037918877 8:22790032-22790054 GTGGCCCAGGAGAGGGATGACGG - Intronic
1038689308 8:29746631-29746653 GTGGCCCAGGGGAAATAGAATGG + Intergenic
1039018791 8:33182865-33182887 CCACCCCAGGGGAAGGACGAGGG + Intergenic
1039572706 8:38600419-38600441 TCTGCCCTGGGGAAGGAGGATGG - Intergenic
1039970182 8:42315515-42315537 CAGGGCCAGGGGAAGGAGTTTGG + Intronic
1040459630 8:47634769-47634791 CTGGCCCAGGCGTGAGAGGATGG - Intronic
1040534105 8:48290982-48291004 GGTGCACAGGGGAAGGAGGAGGG - Intergenic
1040561084 8:48524072-48524094 CTGGCCCAGGAAAGGGAGCACGG - Intergenic
1041260780 8:56019109-56019131 CTGGCCCTGGGGGATTAGGAGGG + Intergenic
1041978931 8:63832860-63832882 CTGGCCCAAGGGCAGGAAGCTGG - Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1045564533 8:103299347-103299369 CTGTCCCGGGGGAAGGGCGAAGG - Intronic
1045684785 8:104701266-104701288 CTTGCCTAGGGAAGGGAGGATGG + Intronic
1046061445 8:109144670-109144692 CTGGACAAAGGGAAGGAGCAGGG - Intergenic
1047555389 8:125923700-125923722 CTGGCCCTGGGGCAGCAGAAGGG - Intergenic
1048012227 8:130467035-130467057 CTGACCCAGGGGAAAGAGGAGGG + Intergenic
1048447904 8:134505660-134505682 CTGGCTCTGGGGATGGAGGAAGG + Intronic
1049042841 8:140125231-140125253 CTGGCCCAGGGGCACTCGGAGGG + Intronic
1049076531 8:140400755-140400777 CGGGAGCAGGGAAAGGAGGAAGG + Intronic
1049160788 8:141096248-141096270 AAGTCCCAGGGGCAGGAGGAGGG + Intergenic
1049230414 8:141478766-141478788 CTGGCCCAGGGGTGGCAGGCAGG + Intergenic
1049252885 8:141598642-141598664 GAGGCCAAGGGGGAGGAGGAAGG - Intergenic
1049291460 8:141805140-141805162 GTATCCTAGGGGAAGGAGGATGG + Intergenic
1049309619 8:141926693-141926715 CTGTCCCAGGGGCTGGAGGCTGG + Intergenic
1049349853 8:142158753-142158775 ATGGGCCAGGGGAAGGCGGCCGG - Intergenic
1049390060 8:142363205-142363227 GTGGCCCAGAGGAAGCAGCAGGG + Intronic
1049474944 8:142792816-142792838 CTTGCCCAGAGGAGGCAGGATGG - Intergenic
1049526547 8:143129752-143129774 CAGGGCTGGGGGAAGGAGGAGGG + Intergenic
1049786630 8:144454048-144454070 CTGGCCCAGGACAAGGACAAGGG + Intronic
1051001398 9:12286961-12286983 CTGGCCCAGTGGAAGAAACAAGG - Intergenic
1051483700 9:17586219-17586241 TTGACCCAGGGGATGGCGGAGGG - Intronic
1052998406 9:34564135-34564157 GAGGCCCCAGGGAAGGAGGAAGG - Intronic
1053196465 9:36122987-36123009 CAAGCTGAGGGGAAGGAGGAGGG - Exonic
1053402750 9:37841145-37841167 CAGATCCAGGGGCAGGAGGAAGG + Intronic
1054724936 9:68640846-68640868 CTGGCACAGAGTAAGGAGGCAGG - Intergenic
1054925397 9:70583902-70583924 ATAGCCCAGGGGAAGGTGGGTGG - Intronic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055789638 9:79910130-79910152 CTGCCCAAGGGAGAGGAGGAGGG + Intergenic
1055872650 9:80902085-80902107 GTGGGTCAGGGGAAGGAGGGAGG + Intergenic
1056691424 9:88811730-88811752 CTGGCCCAGGGGAGCCAGGCTGG - Intergenic
1056765455 9:89442129-89442151 CTGGGCCAGGGGAAAAGGGAAGG - Intronic
1056773279 9:89495184-89495206 ATGCCCCAGGGGAAGCAGCAAGG + Intronic
1056809000 9:89749986-89750008 CTGGGCCAGGGGCAGGATCATGG - Intergenic
1057307478 9:93920630-93920652 CAGGCCCACGAGGAGGAGGAGGG + Intergenic
1057904636 9:98974494-98974516 CTGACAAAGGGCAAGGAGGAGGG + Intronic
1060670688 9:125466751-125466773 GGGACCCAGGGGAAGGAGGAAGG - Intronic
1060813148 9:126621221-126621243 CTCAGCCAGGGGAGGGAGGAAGG + Intronic
1060944520 9:127562037-127562059 CTGCCCGCGGGGAAGGAGGAGGG + Intronic
1061085074 9:128393666-128393688 CTGGCCCAGGAGAAGGGAGGGGG - Intergenic
1061086964 9:128405106-128405128 TGTGGCCAGGGGAAGGAGGAGGG - Intergenic
1061255342 9:129451919-129451941 ATGGCCCAGGGGCAGGAGCCAGG + Intergenic
1061371791 9:130201541-130201563 CTGGGCCTGGGGGAGGAGGGCGG + Intronic
1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG + Intergenic
1061537826 9:131260461-131260483 GGGGCTCAGGGGCAGGAGGAGGG - Exonic
1061619661 9:131803641-131803663 ATGGACCAGAGGTAGGAGGAGGG + Intergenic
1061678300 9:132230521-132230543 CTGCCCCAGGGGAAGGGGCCTGG - Intronic
1061857425 9:133449856-133449878 CGGGCCCATGGGGAGGACGATGG + Exonic
1062086292 9:134650662-134650684 CTGGCCCTGGAGAAGCAGGCTGG - Intronic
1062248466 9:135582409-135582431 ATGGCCCGGGGGATGAAGGATGG + Intergenic
1062261409 9:135664960-135664982 CTGGCCCAGGGGAAGCAGGGAGG + Intronic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062390080 9:136330375-136330397 CGGGGACAGGGGAGGGAGGAAGG - Intronic
1062624456 9:137436493-137436515 CTGGCCCTGGGGAGGGTGCATGG - Intronic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1185604338 X:1359221-1359243 CTGGCCCAGGGTAAGGAATCTGG - Intronic
1187088400 X:16066572-16066594 CTGACACAGGATAAGGAGGAAGG - Intergenic
1188707605 X:33355293-33355315 CTGGCACAGGGGAAAGATGCAGG - Intergenic
1189286268 X:39854456-39854478 CTGGGGCCGGGGAAGGAGGCTGG - Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1190233876 X:48601530-48601552 CTGGCCAAGGGGCAGCATGATGG + Intronic
1192135786 X:68599105-68599127 CTGAGCCAGGGGAAGGAACAGGG - Intergenic
1192240460 X:69323985-69324007 CTGTCTCTGGGGACGGAGGATGG + Intergenic
1192358709 X:70425388-70425410 CCAGCTCAGGGAAAGGAGGAAGG - Exonic
1192576251 X:72245594-72245616 ATCTCCCAGGGGAAGCAGGAAGG + Intronic
1192803981 X:74493885-74493907 CTGGCCCAGGGCTGGGGGGATGG - Intronic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1195129488 X:101839420-101839442 CTGGCCCCGGGGACCGAGGCAGG + Intronic
1195176750 X:102320409-102320431 CTGGCCCTGGGGACCGAGGCAGG - Intronic
1195182114 X:102366684-102366706 CTGGCCCTGGGGACCGAGGCAGG + Intronic
1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG + Intronic
1195767175 X:108308117-108308139 GTGGCTGAGGGGATGGAGGATGG - Intronic
1195913338 X:109911620-109911642 CTGGGCCAGAGGTAGGAAGAGGG + Intergenic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1199791625 X:151160863-151160885 CTGTCCCAGTGGAGGGAGGCAGG - Intergenic
1199846332 X:151695077-151695099 CTGGCCGAGTGGAGGAAGGAGGG - Intergenic
1200167264 X:154045364-154045386 CTGCCACAGGGGAAGCAGCAGGG + Intronic
1200216291 X:154369514-154369536 CTGGCCCAGGGGCTGGGGAAAGG - Intronic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1201190395 Y:11438827-11438849 CAGGACCAGGGTCAGGAGGAGGG - Intergenic