ID: 1114613360

View in Genome Browser
Species Human (GRCh38)
Location 14:24056033-24056055
Sequence CCACCCTGCTTGGTAGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114613360_1114613364 -5 Left 1114613360 14:24056033-24056055 CCATTAACTACCAAGCAGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1114613364 14:24056051-24056073 GGTGGGCTGCTCCAGTCTTGAGG 0: 1
1: 0
2: 0
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114613360 Original CRISPR CCACCCTGCTTGGTAGTTAA TGG (reversed) Intronic
907158514 1:52355280-52355302 CCACCCCACTTGGGAGATAAAGG - Intronic
908522949 1:64962535-64962557 CCAGCCTTCTTGGCAGTTTAAGG - Intronic
909913925 1:81294364-81294386 CCGCCATGCTTGGTACTCAAGGG - Intergenic
910117719 1:83750956-83750978 CCACCCTGCTGGGTGGCTGATGG + Intergenic
914259210 1:145984859-145984881 CCACCCTGCTTTGTGGTTGGAGG - Intergenic
914917082 1:151825486-151825508 CCAGCCTGCTTGTGAGTAAAAGG - Intronic
917570863 1:176263839-176263861 CCATCCTGCTAGGTAGTAAGCGG - Intergenic
920183428 1:204146550-204146572 CCACCCTGCTAGGAGGTTTAAGG - Intronic
924024276 1:239816580-239816602 CCACCTTGCTTGGTACTTCCTGG - Intronic
924202892 1:241678775-241678797 GCACCCTTCTTTGTAGTTCAGGG - Intronic
1063092212 10:2875232-2875254 CCACCCTGCTTGGGACCTGATGG - Intergenic
1069394898 10:67977692-67977714 CCACCATGCCTGGTCCTTAAGGG - Intronic
1072698629 10:97623290-97623312 CCACCATGCTTGGTTGATAGAGG - Intronic
1073803379 10:107068577-107068599 CCACCATGCTCGGCAGTTCATGG - Intronic
1074715889 10:116218302-116218324 CCACACTCCCTGGTAGGTAAGGG + Intronic
1074908461 10:117885477-117885499 ACCCACTGCTTGGTGGTTAATGG + Intergenic
1077508574 11:2943494-2943516 CCACCCAGCTAGGTAGTGAGGGG + Intergenic
1083625857 11:64071671-64071693 CCCCCCAGCTTGGTGGTTATGGG + Intronic
1086742957 11:90390460-90390482 CCAGCTTGCTGGGTAGATAATGG - Intergenic
1092599626 12:10045318-10045340 CCAACCTGCTTGGTAGTACAAGG - Intronic
1103743633 12:123107674-123107696 GCACCCTGCTTGGGAGTTTGTGG - Intronic
1104086262 12:125476971-125476993 CCACCCAGATTGGTAGTTGTTGG + Intronic
1113797500 13:113066903-113066925 CCACGCTGCGTGGGAGTCAAAGG - Intronic
1114283886 14:21221585-21221607 CCATCCTGCTCTGTAGTTATAGG - Intronic
1114613360 14:24056033-24056055 CCACCCTGCTTGGTAGTTAATGG - Intronic
1118360160 14:65049234-65049256 CCACTTGGCTTGGTAGTTACTGG + Intronic
1119013691 14:71025431-71025453 CCACCTTTTTTGGTAGGTAATGG + Intronic
1119614101 14:76087023-76087045 CCTTCCTGCTTAGTAGGTAAGGG + Intergenic
1132505489 16:306430-306452 CCACCCTGCTTGCTTGTCACAGG - Intronic
1138193350 16:55034190-55034212 CCACCCAGATTGGTACTTCAAGG + Intergenic
1138273200 16:55710704-55710726 CCAACCTGTTTGCTAATTAAAGG - Intergenic
1140891495 16:79289024-79289046 CCAGCCTGTTTGTTTGTTAAAGG + Intergenic
1141050277 16:80755272-80755294 CCAGACTCCTTGGTAATTAAAGG - Intronic
1142992869 17:3743403-3743425 CCACCATTCTTGGAAGTTAGGGG + Intronic
1144888030 17:18477225-18477247 CTACCCGGCATGGTAGTTAAGGG + Intronic
1145144177 17:20467078-20467100 CTACCCGGCATGGTAGTTAAGGG - Intronic
1145175632 17:20698491-20698513 CTACCCGGCATGGTAGTTAAGGG - Intergenic
1145368954 17:22292110-22292132 CCACCCATCTTGGTAATTTAGGG + Intergenic
1145791686 17:27631642-27631664 CTACCCGGCATGGTAGTTAAGGG + Intronic
1146011276 17:29196810-29196832 CCATCCTGCTTGGTCTTTGAGGG - Intergenic
1154366782 18:13717473-13717495 AAACCCTGCTTTGTAGTTAGCGG - Intronic
1161209534 19:3058975-3058997 CCACCCTGCGAGGTTGTTAGTGG - Intronic
1162272702 19:9629418-9629440 CCACCCTGATGTGTGGTTAAAGG + Intronic
928083843 2:28333379-28333401 GCACCCTGCTTTGTAGGTGAGGG + Intronic
930881150 2:56271970-56271992 ACACCCTGATTGGGAGCTAAAGG + Intronic
938369531 2:130760636-130760658 CCACCTTTCTTGGTAGTGAGTGG - Intronic
939756408 2:146117529-146117551 CCAATCTGGTTGGTATTTAATGG - Intergenic
943176220 2:184478139-184478161 CCACCATGCCTGGTGGCTAATGG - Intergenic
944511348 2:200469260-200469282 CCACCTTGTATTGTAGTTAATGG + Intronic
945832322 2:214802596-214802618 GCACCATGCTAGGTAGGTAATGG - Intronic
946929936 2:224661440-224661462 CCACCGTGCTTGGCCGTGAAAGG + Intergenic
1174450988 20:50620259-50620281 CCACACTGCTTGGTGGTGATGGG - Intronic
1177051586 21:16241741-16241763 CCACCCTGCTGGCTAGTAATGGG - Intergenic
1177496096 21:21894463-21894485 CCACCCTGCTTAGCAGTTCAAGG - Intergenic
1177574378 21:22932071-22932093 CTACCCCTCTTGTTAGTTAATGG + Intergenic
1183949349 22:41344034-41344056 TCAGCCTGGTTGGTATTTAATGG + Intronic
949582502 3:5403199-5403221 CTACCCTGCTTGGTACATATAGG - Intergenic
949926797 3:9048124-9048146 CCAGCCTGCTTCCTAGTTCAGGG + Intronic
952197861 3:31094991-31095013 CCACACTGCTTGGTACTTTTAGG - Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
957900804 3:86486759-86486781 GCACCCTGCTAAGCAGTTAAAGG - Intergenic
965417622 3:168416692-168416714 CCATCCTGCTTGGTCATTAGAGG + Intergenic
972025170 4:34366451-34366473 CCAGCCTTGTTGGTAGATAAGGG - Intergenic
977970294 4:103205510-103205532 CCAGCCTGCCTTGCAGTTAAGGG + Intergenic
982643606 4:157994161-157994183 CCACCATGCCTGGCAGTTTAAGG - Intergenic
998106352 5:139471598-139471620 CCACCCTGCTTGGTATTAGATGG - Intergenic
998236526 5:140402554-140402576 CCACCCTGCTTTGGAGTTGGGGG + Intronic
998593914 5:143507606-143507628 CCACCCTACTTGGTACTTGCTGG + Intergenic
999866408 5:155705148-155705170 CCAGCCTCCTTTGTAGCTAAAGG + Intergenic
1002095848 5:176830248-176830270 CCACCCTGCTTGGGAGCTCCTGG - Intronic
1002650333 5:180687054-180687076 CCACCCTCCTTGGTGGTGAAGGG + Intergenic
1003280924 6:4690658-4690680 GCACCCTGCTTGGCAGGTGAAGG - Intergenic
1004908325 6:20258357-20258379 CCAGACTGGGTGGTAGTTAAAGG + Intergenic
1012069105 6:94589537-94589559 ACAGTCTTCTTGGTAGTTAAAGG - Intergenic
1014774753 6:125495413-125495435 CCACTCTTCTTGGTAGTTCTGGG + Intergenic
1015427951 6:133094224-133094246 GCACCCTGCTTAGTAAGTAAGGG + Intergenic
1020398955 7:7752946-7752968 CCACCCTGGTCTGTAGTTAATGG + Intronic
1033329928 7:140409405-140409427 CCACCGTGCCTGGCAGTTTATGG - Intronic
1051091846 9:13418945-13418967 CCACTCTGATTGGTAGTGGAAGG - Intergenic
1052028121 9:23597353-23597375 ACAACCTGCTTGTTAGTGAAGGG + Intergenic
1187752593 X:22483954-22483976 CCACTAGGATTGGTAGTTAAAGG + Intergenic
1192885825 X:75335241-75335263 CCACCCTGCCTGGGAGGTGAGGG - Intergenic
1199734863 X:150676377-150676399 GCACCCTGCTTGGAAATTACTGG - Intergenic