ID: 1114614478

View in Genome Browser
Species Human (GRCh38)
Location 14:24060964-24060986
Sequence CTGCCGCACAGGCCCATCAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114614478_1114614483 17 Left 1114614478 14:24060964-24060986 CCAATGATGGGCCTGTGCGGCAG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1114614483 14:24061004-24061026 AAGTGAGGTGTCCAAAGCTGTGG 0: 1
1: 0
2: 1
3: 13
4: 203
1114614478_1114614482 2 Left 1114614478 14:24060964-24060986 CCAATGATGGGCCTGTGCGGCAG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1114614482 14:24060989-24061011 GCTGGAATCAGTAGCAAGTGAGG 0: 1
1: 0
2: 1
3: 10
4: 151
1114614478_1114614484 23 Left 1114614478 14:24060964-24060986 CCAATGATGGGCCTGTGCGGCAG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1114614484 14:24061010-24061032 GGTGTCCAAAGCTGTGGACAAGG 0: 1
1: 0
2: 2
3: 19
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114614478 Original CRISPR CTGCCGCACAGGCCCATCAT TGG (reversed) Exonic