ID: 1114614822

View in Genome Browser
Species Human (GRCh38)
Location 14:24062756-24062778
Sequence ACAGATCCTGCCCTTGGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 272}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114614822_1114614834 13 Left 1114614822 14:24062756-24062778 CCCAGGCCAAGGGCAGGATCTGT 0: 1
1: 0
2: 1
3: 33
4: 272
Right 1114614834 14:24062792-24062814 AGGCCGGAACCATGACCATGAGG 0: 1
1: 0
2: 1
3: 7
4: 62
1114614822_1114614828 -7 Left 1114614822 14:24062756-24062778 CCCAGGCCAAGGGCAGGATCTGT 0: 1
1: 0
2: 1
3: 33
4: 272
Right 1114614828 14:24062772-24062794 GATCTGTCCTCCCGGGGCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 105
1114614822_1114614829 -3 Left 1114614822 14:24062756-24062778 CCCAGGCCAAGGGCAGGATCTGT 0: 1
1: 0
2: 1
3: 33
4: 272
Right 1114614829 14:24062776-24062798 TGTCCTCCCGGGGCCGAGGCCGG 0: 1
1: 0
2: 0
3: 29
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114614822 Original CRISPR ACAGATCCTGCCCTTGGCCT GGG (reversed) Exonic
900805394 1:4764036-4764058 TCTTCTCCTGCCCTTGGCCTTGG + Intronic
901884732 1:12215012-12215034 GCCAAGCCTGCCCTTGGCCTGGG + Intergenic
902038345 1:13473816-13473838 TCTTCTCCTGCCCTTGGCCTGGG + Intergenic
903650306 1:24917934-24917956 CCAGCCCATGCCCTTGGCCTTGG - Intronic
903860163 1:26360200-26360222 CCAGATGCTGCCCGTGCCCTGGG + Intergenic
904431968 1:30470132-30470154 ACAGGTGCAGCCATTGGCCTGGG + Intergenic
905327953 1:37171253-37171275 ACACATCCTCGCCTTGTCCTGGG + Intergenic
906535828 1:46550503-46550525 TCTGGTCCTGCCTTTGGCCTGGG + Intronic
909564884 1:77043206-77043228 ACATTTGCTGGCCTTGGCCTCGG + Intronic
909599405 1:77446004-77446026 AAAGATCTTGACATTGGCCTTGG - Intronic
910415853 1:86997295-86997317 AGAAATCCTGCCCTGGGCCTGGG - Intronic
912944903 1:114076693-114076715 TCAGTTCCTTCCCTTGGCCTTGG + Intergenic
914231737 1:145768189-145768211 TCAGATCCTGCCCATCCCCTGGG + Intronic
914315981 1:146512313-146512335 TCAAATCCTGGGCTTGGCCTTGG - Intergenic
914462391 1:147897312-147897334 CCAGACCCAGCCCCTGGCCTGGG + Intergenic
914498374 1:148221048-148221070 TCAAATCCTGGGCTTGGCCTTGG + Intergenic
915508933 1:156375392-156375414 ACATATCCAGCCCTTGTCCAGGG + Intronic
918094930 1:181326606-181326628 ACACATCCCTCCCTTTGCCTTGG + Intergenic
920260223 1:204684100-204684122 ACGGAGCCTGCCATCGGCCTGGG + Intronic
920921991 1:210305278-210305300 ACAGATGCAGCCCAGGGCCTGGG + Intergenic
921737220 1:218642483-218642505 TCAGATCCCGCCCCTGGCCTGGG - Intergenic
923041830 1:230325163-230325185 TAAGATCCTGCCCTCAGCCTGGG - Intronic
1063429521 10:5977120-5977142 ACTGCTCCTGACCTCGGCCTCGG + Intronic
1067664229 10:48260368-48260390 TCATCTCCTGCCCTTGGACTGGG - Intronic
1069504971 10:68989324-68989346 ACAACGTCTGCCCTTGGCCTTGG - Intronic
1069596572 10:69675839-69675861 TCAGTTCCTGCCCTTGGACTGGG - Intergenic
1069773271 10:70912616-70912638 AAATAGCCTGCCCTGGGCCTGGG + Intergenic
1070784137 10:79153399-79153421 TCAAATCCAGCCCTTGACCTAGG - Intronic
1070890686 10:79940574-79940596 GCAGAGCCTGCCCTGGGTCTAGG - Intronic
1073715510 10:106102116-106102138 ACAGATCCTGCCATTTGGATGGG + Intergenic
1073934498 10:108614855-108614877 ACAGATACTGTTCTTTGCCTGGG + Intergenic
1074867413 10:117553079-117553101 ACAGATGTTGCCCTAGGGCTGGG - Intergenic
1075099935 10:119499088-119499110 ACTGAGCCTGACCTTGGCCCTGG + Intergenic
1076541759 10:131219420-131219442 CCAGAGCCTGCTCCTGGCCTGGG - Intronic
1076982295 11:211049-211071 TCAGTCCCTGCCCTTGGCTTTGG + Intronic
1077499161 11:2901544-2901566 CCAAGCCCTGCCCTTGGCCTGGG - Intronic
1077578467 11:3402195-3402217 ACAGATCCTGCCACAGGCCTGGG - Intergenic
1080251493 11:30238799-30238821 ACAGATTCTTCTCTTGGCCAAGG - Intergenic
1080896661 11:36453880-36453902 CAAGCTCCTCCCCTTGGCCTGGG - Intronic
1080922631 11:36723963-36723985 CCACATCCTTCCCATGGCCTGGG - Intergenic
1081717415 11:45260231-45260253 TCAGACTCTGCTCTTGGCCTGGG - Intronic
1082997191 11:59263628-59263650 GCAGTTGCGGCCCTTGGCCTCGG - Intergenic
1083890828 11:65595093-65595115 ACAGATCAGGACCATGGCCTCGG - Intronic
1084235506 11:67785711-67785733 ACAGATCCTGCCACAGGCCTGGG - Intergenic
1084677502 11:70644546-70644568 GCTGGTCCTGCCCTTGGCCGGGG - Intronic
1085324851 11:75598770-75598792 AGAGATCTGGCCCTTGCCCTGGG + Intronic
1087727482 11:101738621-101738643 ACAAATGCAGCCCTTGGCATAGG + Intronic
1087815897 11:102658565-102658587 ACAGAAGCTTCCCTTGCCCTAGG + Intergenic
1089016002 11:115166067-115166089 CCAGATACTGCACTTGGCTTCGG + Intergenic
1089257469 11:117201441-117201463 AGAGAGCCTGCCCTTGACCAAGG - Intronic
1089563127 11:119355888-119355910 AGGGATCCTGCCCTTAGCCCTGG - Exonic
1089708673 11:120299414-120299436 ACAGCTTCTGCCCTCAGCCTAGG - Intronic
1089741861 11:120590047-120590069 CCAGCTCCAGACCTTGGCCTTGG - Intronic
1090657494 11:128857114-128857136 GCAGCTCCTGCCCTGGGCTTCGG + Intronic
1091095194 11:132814433-132814455 TCAGCTTCTGCCCTTGGGCTGGG - Intronic
1091124264 11:133082134-133082156 GCTTGTCCTGCCCTTGGCCTGGG - Intronic
1091191389 11:133698357-133698379 TCAAAACCTGCCCTTGACCTTGG - Intergenic
1092872053 12:12813916-12813938 AAAGCACCTGGCCTTGGCCTTGG + Intronic
1094833752 12:34312673-34312695 GCAGAACCTGCACTTGGCCCGGG - Intergenic
1095477252 12:42598073-42598095 ACAGATCCTGAGCTCGGGCTGGG - Intergenic
1096242896 12:49968698-49968720 TCAGCACCTGCCCTGGGCCTTGG - Intronic
1096664581 12:53154718-53154740 ACCCATCTTGCCCTTGGCCTGGG - Intergenic
1098624270 12:72643483-72643505 ATAGAACCTGCCCTTGTTCTAGG + Intronic
1099891971 12:88600422-88600444 ATATATCTGGCCCTTGGCCTAGG - Intergenic
1099996353 12:89783655-89783677 ACAGAGGCTGCCCCTAGCCTAGG - Intergenic
1101031655 12:100666821-100666843 GCAGTTCCTGCCTTTGGCCCTGG + Intergenic
1102029242 12:109730505-109730527 CCAGGTGCTGCCCTTGCCCTTGG + Intronic
1102037710 12:109781704-109781726 ACTGCAGCTGCCCTTGGCCTTGG + Intergenic
1103686912 12:122739450-122739472 ACAGGTCTTGCCCTTTGCCCAGG + Intergenic
1103878712 12:124149415-124149437 ACAGGTCCAGCACTTGGCTTTGG + Intronic
1104735856 12:131135759-131135781 ACAGATTCTCCCTATGGCCTAGG + Intronic
1106313196 13:28571707-28571729 ACGGACCCTGCTCTGGGCCTTGG + Intergenic
1106314263 13:28579351-28579373 ACAGATGCTGCCCTTTACCCAGG - Intergenic
1107056281 13:36107972-36107994 GCAGATCCTCCCCTTGGACATGG + Intronic
1107357122 13:39579241-39579263 AGAGTATCTGCCCTTGGCCTGGG - Intronic
1108500286 13:51064076-51064098 TCAGAGCCTGGCCTTGCCCTGGG - Intergenic
1109049340 13:57458514-57458536 AATGATCCCACCCTTGGCCTTGG + Intergenic
1110784633 13:79509608-79509630 ACAACTCCTCCCCTTGGCCAAGG - Intronic
1111269501 13:85863047-85863069 ACAGGTCCTGCCCTTTCTCTTGG - Intergenic
1111639368 13:90947661-90947683 GCAGTTCTTGCCATTGGCCTGGG + Intergenic
1112312161 13:98328340-98328362 ACAGACCCTCCTCTTGGCCAAGG - Intronic
1112581448 13:100679686-100679708 ACAGAGCCTGCCCCTGTGCTTGG - Intergenic
1112884403 13:104151046-104151068 ATAGCTCCTGCCCTTGGACTCGG - Intergenic
1113213702 13:108013158-108013180 AAAGATCCTGGCCTTTACCTTGG - Intergenic
1114614822 14:24062756-24062778 ACAGATCCTGCCCTTGGCCTGGG - Exonic
1116521728 14:45856645-45856667 ACAGATCTTGCACTTGTACTGGG + Intergenic
1117897739 14:60506216-60506238 ACAGTGGCAGCCCTTGGCCTTGG - Intronic
1117997930 14:61495626-61495648 ACAGGTCCTGCCCTCGAGCTTGG + Intronic
1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG + Intronic
1119269510 14:73289889-73289911 ACAACTTCTGCCCTAGGCCTAGG - Intronic
1119517830 14:75262251-75262273 ACACATCCTGGCCTGGGCCAAGG - Intronic
1119539969 14:75431598-75431620 CCAGCACCTGCCCTCGGCCTCGG - Intronic
1121789044 14:96685108-96685130 ACATACCCTTCCCATGGCCTTGG - Intergenic
1122976970 14:105174712-105174734 ACAGGCCCGGCCCTTGGCCCGGG + Intronic
1122985182 14:105208594-105208616 AGCGATCCAGCCCTCGGCCTGGG - Intergenic
1123001844 14:105300067-105300089 ATTGCTGCTGCCCTTGGCCTTGG - Intronic
1123946015 15:25239259-25239281 ACAGAGCCTGCCCCTGGGCATGG - Intergenic
1123948840 15:25251805-25251827 GCAGAGCCTGCCCTTGGGCATGG - Intergenic
1125752933 15:42042754-42042776 CCAGATCCTTCTCTTTGCCTTGG + Intronic
1125967868 15:43888675-43888697 CCAGGTCCTGACCTTGGTCTTGG + Intronic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1127608943 15:60618286-60618308 GCAGAGGTTGCCCTTGGCCTTGG - Intronic
1128270641 15:66306223-66306245 AGAGATCCTTCCCATGGCCGAGG - Intronic
1128691432 15:69727296-69727318 ACAGATCCTGTTCTTGTGCTTGG + Intergenic
1128753372 15:70164627-70164649 ACAGCTTCTGCTCTTGCCCTTGG - Intergenic
1129494927 15:75970477-75970499 ACAGAGCTGGGCCTTGGCCTAGG + Intronic
1130046988 15:80453275-80453297 ACAGGTCCTGCCCTTGCCCCTGG - Intronic
1130543812 15:84840491-84840513 ACACTTCCTGGCCTGGGCCTGGG - Exonic
1132608339 16:802748-802770 CCTCCTCCTGCCCTTGGCCTTGG - Intergenic
1132974164 16:2703248-2703270 GCAGAATCTGACCTTGGCCTGGG + Intronic
1133347071 16:5078345-5078367 ACAGATCCTGCCACAGGCCTGGG - Intronic
1135573520 16:23567437-23567459 ACAAAACTTGCCCTTAGCCTTGG + Intronic
1138133387 16:54500962-54500984 ACAGATCCTGTCCTTGGTAGGGG - Intergenic
1138457794 16:57131373-57131395 ACATCTCCTGCCCTGGCCCTTGG - Intronic
1138541305 16:57689319-57689341 CCAGACCCTGTGCTTGGCCTGGG - Exonic
1139715098 16:68806779-68806801 CCAGAGCCTGCCCTTGGCGCAGG + Intronic
1141306430 16:82868500-82868522 AGAGATCCTTCCATTGGACTTGG + Intronic
1143002437 17:3803062-3803084 ACAGAGCCTGGCCCTGACCTTGG - Intergenic
1143951678 17:10637724-10637746 ACACACCCTGCCCTTGGTTTTGG + Intronic
1144728399 17:17513123-17513145 ACAGAGCATGCCCCAGGCCTCGG - Intronic
1150847357 17:68673125-68673147 ACAGGCCCTGCCCTTGATCTGGG - Intergenic
1151373569 17:73666626-73666648 ACAGCCCCTGCCCCTGCCCTGGG - Intergenic
1152146942 17:78574068-78574090 ACGGTTGCTGCCCATGGCCTGGG - Intronic
1152615160 17:81334503-81334525 ACAGCTCCTCCCCTTCCCCTGGG - Intergenic
1153218204 18:2839442-2839464 CCTGATTCTGCCCTTGGGCTGGG - Intergenic
1154470211 18:14693339-14693361 ACCACTGCTGCCCTTGGCCTGGG - Intergenic
1155659409 18:28229971-28229993 ACAGATCCTGCACTTCGGGTCGG - Intergenic
1156133196 18:34003801-34003823 ACAGATCCTCCCCCTGGCCAAGG + Intronic
1156389595 18:36638252-36638274 ACATGGCATGCCCTTGGCCTGGG - Intronic
1158962124 18:62596184-62596206 ACGGAACCTCCCCTGGGCCTGGG + Intergenic
1159152494 18:64538009-64538031 ACAAATCCTGTCGTTGCCCTCGG - Intergenic
1159654697 18:71018984-71019006 ACACTTCCTTCCCTTGGCTTTGG - Intergenic
1159793144 18:72809077-72809099 ACAGATTCTGCCCTTGGTAAAGG - Intronic
1160668606 19:345010-345032 CCTGATCTTGGCCTTGGCCTTGG + Intergenic
1160878888 19:1310732-1310754 ACAGAGGCTGCCCTTGGCAGTGG + Intergenic
1162001244 19:7746442-7746464 TCAGAACCTGCCCCTGACCTTGG + Exonic
1162003935 19:7765264-7765286 TCAGAACCTGCCCCTGACCTTGG - Exonic
1162056136 19:8065346-8065368 GTAGATGCTGCCCTTGGACTGGG - Intronic
1163569789 19:18074353-18074375 ACAGCTGCTGCCCTGAGCCTGGG - Intronic
1164669310 19:30063700-30063722 ACAGACCCTGACCCAGGCCTGGG + Intergenic
1166340782 19:42135372-42135394 CCAGAGGCTGCCCCTGGCCTGGG - Intronic
1166535572 19:43572129-43572151 ACAGAACCTGTCTCTGGCCTGGG - Intronic
1166962300 19:46505302-46505324 ACTGAGACTGCCCTTGGCATAGG + Intronic
1167119843 19:47510236-47510258 ACAGGGCCTGCCCAGGGCCTTGG - Intronic
925276342 2:2650984-2651006 CAGGATCCTGCCCTTGGCATCGG - Intergenic
925852101 2:8091785-8091807 TCAGATCCTGCCCTTCTCATGGG - Intergenic
926764553 2:16312878-16312900 TCAGCTCCTGCCCTTGCTCTAGG - Intergenic
928175076 2:29027952-29027974 CCAACTCCTGACCTTGGCCTAGG - Intronic
928206069 2:29284592-29284614 ACAGATCCGGCCCATGAGCTTGG - Intronic
928442171 2:31301643-31301665 GCAGATCCTACCCTTGGACATGG + Intergenic
930378068 2:50592563-50592585 ACAGAGCTTGCTCTTGGCTTAGG + Intronic
931359284 2:61564512-61564534 TCAGATACTGCCTGTGGCCTTGG - Intergenic
931387709 2:61812005-61812027 ACAGAACGTACCCTGGGCCTGGG - Intergenic
932483195 2:72062292-72062314 ACAGACCCTGCTCTTGGCCAAGG + Intergenic
932605478 2:73162955-73162977 ACGGCTCCTGCCCATGGCCAAGG - Intergenic
934027647 2:88014606-88014628 ACAGATACTACCCTTGATCTTGG - Intergenic
935129727 2:100252629-100252651 TCAGATCCGGCCTTTAGCCTGGG - Intergenic
936008343 2:108909348-108909370 CCAGGTCCTGCCCTTGGTCCTGG + Intronic
936463762 2:112729409-112729431 ACCGCGCCTGGCCTTGGCCTGGG + Intronic
937095025 2:119229714-119229736 AAAGATCCAGCCCAAGGCCTTGG - Intronic
937272387 2:120661248-120661270 AAAGAGCCTGCCTTTGACCTCGG + Intergenic
937318929 2:120949124-120949146 ACAGGACCTGCCCTTGTCCAGGG + Intronic
937385589 2:121429035-121429057 ACAGAACCTTCCTGTGGCCTAGG - Intronic
937972204 2:127559518-127559540 ACAGCTCTTGCACTTGGGCTAGG + Intronic
938219291 2:129551819-129551841 AAAGAGCCAGGCCTTGGCCTCGG + Intergenic
941269468 2:163407689-163407711 ACAGATTCTGCCTGTGTCCTTGG + Intergenic
941272832 2:163451813-163451835 ACTGATCGTGCCTTTGCCCTTGG - Intergenic
942042545 2:172080615-172080637 ACAAATCCTGGCCCTGGACTCGG + Exonic
942358686 2:175148492-175148514 ACAGACCCTTCCCTTGGCCCAGG + Intronic
945234843 2:207624884-207624906 ACAGAACCTGCCCTTAGACTGGG + Intronic
946174912 2:217916638-217916660 ACAGATGTTGCCCAAGGCCTTGG - Intronic
947702086 2:232242968-232242990 ACAGATTCTGGTCTTGCCCTGGG + Intronic
947704687 2:232264789-232264811 ATAGGTGCTGCCCTGGGCCTAGG + Intronic
947722823 2:232379945-232379967 CCAGCCCCAGCCCTTGGCCTGGG - Intronic
947812058 2:233010894-233010916 AAAATTCCTTCCCTTGGCCTGGG - Intronic
947837001 2:233183172-233183194 GCCCATCCAGCCCTTGGCCTAGG + Intronic
948453701 2:238094139-238094161 AAAGATCATGCCCCTGGCCTAGG - Intronic
948599476 2:239100156-239100178 AGAGACTCTGCCTTTGGCCTGGG + Intronic
948909873 2:240997805-240997827 TCAGACCCTGCCATGGGCCTGGG + Intergenic
1172099113 20:32474944-32474966 ACAGTGCCGGCCCTTAGCCTTGG - Intronic
1172639668 20:36433113-36433135 CCAGATCCTGTCCTGGGCCTTGG - Intronic
1173022488 20:39278616-39278638 CCAGATCCTGCCCTTCTCCACGG - Intergenic
1175517755 20:59579603-59579625 CTAGAACCTGCCATTGGCCTCGG - Intronic
1176009727 20:62886493-62886515 ACAGATCCTGGTTTTGGTCTTGG - Intronic
1176162334 20:63654027-63654049 TCAGATCCTGCCCATCCCCTGGG - Intergenic
1176804284 21:13464526-13464548 ACCACTGCTGCCCTTGGCCTGGG + Intergenic
1179534568 21:42043162-42043184 ACAGAGCCTCCGCTTGTCCTTGG - Intergenic
1179875798 21:44266791-44266813 ACTCAACCTGGCCTTGGCCTGGG + Intergenic
1181014612 22:20061906-20061928 ACTGAGCCTCCCCTGGGCCTGGG - Intronic
1181665818 22:24396025-24396047 CAAGATTCTGCTCTTGGCCTTGG + Intronic
1183665882 22:39245381-39245403 TCAGATCCTGCCCTGGCACTCGG + Intergenic
1184107887 22:42379042-42379064 CCAGATCCTGGCCTTGGCTCAGG - Intergenic
1184387602 22:44185336-44185358 GCAGATGCTGGCCATGGCCTTGG + Intronic
1184580328 22:45412956-45412978 ACTGCTCTTGCCCTTGGCCCTGG - Intronic
1185010563 22:48310601-48310623 ACAGAACCAGCTCCTGGCCTCGG + Intergenic
1185370992 22:50460827-50460849 ACAGATACAGGCCTTTGCCTGGG - Intronic
949505992 3:4728160-4728182 ACAGATCTACCCCTTGGCCAAGG - Intronic
949707399 3:6834781-6834803 ACAGATCCAGCCCTCAACCTGGG - Intronic
949906240 3:8861042-8861064 TCTTTTCCTGCCCTTGGCCTGGG + Intronic
950111449 3:10421286-10421308 ACAGAGCCTGCACTCAGCCTGGG + Intronic
950455997 3:13093117-13093139 ACAGGTCCTGCCCCTGCCCAGGG + Intergenic
952118107 3:30208561-30208583 ACAGATCATGCCTTTGGTGTTGG - Intergenic
952497790 3:33931205-33931227 ACAGATTCAGCCCTTCGTCTGGG + Intergenic
954303707 3:49714583-49714605 GCAGACCCTGGCCTTGGCTTAGG + Intronic
954681696 3:52349538-52349560 CCAGCTCCTTCCCTTGGCCTGGG - Intronic
957051476 3:75415508-75415530 ACAGATCCTGCCGCAGGCCTGGG - Intergenic
958634381 3:96724365-96724387 ACAAATCCTGCCCATCCCCTAGG + Intergenic
959482493 3:106890391-106890413 ACCTTTGCTGCCCTTGGCCTGGG + Intergenic
959520252 3:107316854-107316876 ATCCCTCCTGCCCTTGGCCTGGG - Intergenic
961176212 3:124837199-124837221 ACAGGGCACGCCCTTGGCCTAGG - Intronic
961329145 3:126128689-126128711 ACACATCCTGCCCTGGGGCCTGG - Intronic
961885066 3:130091688-130091710 ACAGATCCTGCCACAGGCCTGGG - Intronic
962169496 3:133086090-133086112 TCAGATCCTGACCTTGTCCAAGG + Intronic
965118228 3:164519558-164519580 ACAGACCTTGCTCTTGGCCAAGG + Intergenic
965687602 3:171321269-171321291 ACAGATGCTGCCTTTGACCTTGG - Intronic
967065364 3:185910560-185910582 CCAGAGCCTGCCCCTGGGCTGGG + Intergenic
968609947 4:1552391-1552413 ACTGCACCTGCCCTGGGCCTGGG - Intergenic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
968994257 4:3935887-3935909 ACAGGTCCTGCCACAGGCCTGGG - Intergenic
969078370 4:4598867-4598889 TCTGCACCTGCCCTTGGCCTTGG - Intergenic
969091209 4:4695284-4695306 ACAGACCCTGCCCTGTGCTTGGG - Intergenic
969886462 4:10219763-10219785 CTAGATCCTGACCTTGGCCAAGG + Intergenic
970502980 4:16697127-16697149 AAAAATCCTGTCTTTGGCCTAGG + Intronic
970810437 4:20087015-20087037 GCAGATACTGCCCTGGGGCTGGG - Intergenic
974415639 4:61602970-61602992 ACAAATCATTCCTTTGGCCTGGG + Intronic
975779082 4:77820011-77820033 GCAGAGCCTGGCCTTGGCCTTGG + Intergenic
976962301 4:90992921-90992943 ACAGATCCTTCCCATGCCCAAGG + Intronic
978956335 4:114617269-114617291 ACAAACCCTTCCTTTGGCCTTGG + Intronic
981331764 4:143517595-143517617 ACAAATGCTGGCCTTGACCTTGG - Intronic
981577855 4:146223471-146223493 CCAGCTTCTGCCCTTGGCTTTGG + Intergenic
987093388 5:14526975-14526997 ACAGATCCTGGGCTTGACGTTGG + Intronic
988232183 5:28493700-28493722 ACAGATACTGGCCATGGCATTGG + Intergenic
991002262 5:61794264-61794286 TCTCATTCTGCCCTTGGCCTCGG + Intergenic
992150954 5:73902557-73902579 AGTGATCCTGCCCTTTACCTGGG - Intronic
995019555 5:107351827-107351849 GCAGAACCTGCCACTGGCCTAGG - Intergenic
996899029 5:128522212-128522234 ACAGATCTGGCCCTTGTCCTGGG - Intronic
997359479 5:133285583-133285605 GCAGGACATGCCCTTGGCCTTGG - Intronic
998006030 5:138657557-138657579 CCAGAACATGCCCTTGGCCATGG - Intronic
998824227 5:146084572-146084594 ACAGATTCTGGTCTTGCCCTAGG - Exonic
999155692 5:149456021-149456043 AGAGATCATTCCCTCGGCCTAGG - Intergenic
1000121601 5:158203273-158203295 AAGGCTCCTGCCATTGGCCTGGG + Intergenic
1001354267 5:171004627-171004649 ACTGATGCTGCCCATCGCCTTGG - Intronic
1001788074 5:174431060-174431082 AAAGTTACTGCCCCTGGCCTTGG + Intergenic
1001858625 5:175033897-175033919 AAAGATGCTGACATTGGCCTGGG + Intergenic
1003158823 6:3618392-3618414 AAATATCCTGTCCTTGGGCTGGG - Intergenic
1003221140 6:4162003-4162025 TCTCAGCCTGCCCTTGGCCTTGG + Intergenic
1005429819 6:25743734-25743756 ACAGATACTGCTCCTGGCCTGGG + Intergenic
1005629057 6:27690429-27690451 ACAAATCCTGCCCTTAGGCTAGG + Intergenic
1006422266 6:33942478-33942500 ACAGCTGCTGCCCTTTACCTGGG + Intergenic
1006878752 6:37320934-37320956 ACAATTCCTGCCCTCAGCCTGGG + Intronic
1009510200 6:64541145-64541167 ACAGATTCTGGCCTTGACCAAGG + Intronic
1012410288 6:98948137-98948159 AAAGCTCCTCCCCCTGGCCTGGG - Intergenic
1013416211 6:109926924-109926946 ACAGATTCTGCTCTTGCCTTGGG - Intergenic
1014650124 6:124025970-124025992 AGAGATCCTGCCCTGTACCTGGG + Intronic
1016016673 6:139193537-139193559 ACAGATAGTGCCTTTGGCCTGGG - Intergenic
1018441425 6:163817035-163817057 ACAGATGCTGCCCTGAGCCTGGG + Intergenic
1018791235 6:167149599-167149621 ACAGATCCTGAGCTTGGGCTCGG - Intronic
1019217810 6:170454899-170454921 ACAAAGCCAGCCCTGGGCCTTGG - Intergenic
1019525020 7:1476952-1476974 GCAGAGCCTGCCATTGGCCCAGG - Intronic
1019616680 7:1966115-1966137 AGCGCTCCTGGCCTTGGCCTGGG - Intronic
1020318539 7:6924253-6924275 ACAGATCCTGCCACAGGCCTGGG - Intergenic
1024515534 7:50251631-50251653 ACATATTCTGCCATTGTCCTGGG + Intergenic
1028713276 7:93935637-93935659 AGAGATCCGGCCTTTGCCCTTGG + Intergenic
1029119413 7:98256902-98256924 ACAGGTCCTGCCTTTGGCGATGG - Intronic
1032127564 7:129205870-129205892 CCAGATCCTGCCCTGGATCTCGG - Intronic
1033456749 7:141510216-141510238 ACAGCTCCAGTCCCTGGCCTTGG - Intergenic
1035109085 7:156465304-156465326 GCAGAACGTGCCCTTGGCCCAGG - Intergenic
1035960754 8:4134808-4134830 ACAAATTTTGTCCTTGGCCTTGG + Intronic
1036381881 8:8240940-8240962 ACAGATCCTGCCACAGGCCTGGG + Intergenic
1038585488 8:28784909-28784931 CCAGATCCAGCCCATGGCCATGG + Intronic
1039412341 8:37365512-37365534 ACAGCTCCTGCTCTAGGCCCTGG - Intergenic
1040074350 8:43213945-43213967 CTTGATCCTGCCCCTGGCCTGGG + Intergenic
1040275892 8:46013487-46013509 GCAGACCCTGCACTGGGCCTGGG - Intergenic
1041027643 8:53703485-53703507 ACTGCACCTGCCCTGGGCCTTGG - Intergenic
1041624469 8:60009703-60009725 GGAGATGCTGCCCTTGCCCTTGG + Intergenic
1042522505 8:69728999-69729021 ACATTTCCTGCCCTGGACCTCGG - Intronic
1048173114 8:132127330-132127352 ACAATGTCTGCCCTTGGCCTGGG + Exonic
1048324150 8:133426175-133426197 TCTTTTCCTGCCCTTGGCCTTGG + Intergenic
1048492064 8:134902950-134902972 CCAGAACCTCCCCTGGGCCTTGG + Intergenic
1049018714 8:139939505-139939527 GCAGATCCTGCCCTGGGAATGGG - Intronic
1049435377 8:142583936-142583958 ACAAAACCTCCCCTAGGCCTTGG - Intergenic
1049484302 8:142845248-142845270 ACATTTCCTGTCTTTGGCCTGGG + Intronic
1049616724 8:143578731-143578753 CCAGCTCCTGCCCTGGGCCTGGG + Intergenic
1049791611 8:144475012-144475034 CCAGAAGTTGCCCTTGGCCTGGG + Exonic
1049808220 8:144551088-144551110 ACAGATACTGCCTTAGGCCTGGG + Intronic
1050031527 9:1391386-1391408 ACCGATCCTGCTCTTGTTCTGGG + Intergenic
1051353852 9:16223342-16223364 ACAGATACTGCGCTTGTCCCAGG + Intronic
1056487594 9:87074733-87074755 ATTTATCCTGCCCTTGGCCATGG + Intergenic
1057718585 9:97514921-97514943 ACACATCCTGCCCTAGGGCAGGG - Intronic
1059438456 9:114289851-114289873 ACTGAGCCTGCTCTGGGCCTTGG - Intronic
1060034436 9:120242850-120242872 ACAGCTGAGGCCCTTGGCCTGGG - Intergenic
1060299767 9:122368456-122368478 CCAGATCCTATGCTTGGCCTTGG + Intergenic
1060671212 9:125471388-125471410 ACTGTCCCTGCCCCTGGCCTGGG - Intronic
1061539732 9:131271680-131271702 ACTGCCCCTGACCTTGGCCTTGG + Intronic
1061584840 9:131558866-131558888 ACAGATGTTGCCATTGGCCCTGG - Intergenic
1062269370 9:135701659-135701681 CCACATCCTGGGCTTGGCCTGGG - Intergenic
1062503636 9:136861862-136861884 AAAGTTCCTGCCCTTGGCGCTGG - Intronic
1187127902 X:16470972-16470994 ACAGAACCTGCCCTTGGGCTGGG - Intergenic
1190414559 X:50168022-50168044 ATATAGCCTCCCCTTGGCCTGGG + Intergenic
1193583654 X:83294506-83294528 ACTCCTACTGCCCTTGGCCTCGG + Intergenic
1194985353 X:100484246-100484268 AGAAATCCTGCCCTTGGCTTTGG + Intergenic
1200008887 X:153106975-153106997 GCAGAGCCTGGCCTTTGCCTAGG - Intergenic
1200030713 X:153292947-153292969 GCAGAGCCTGGCCTTTGCCTAGG + Intergenic
1200053908 X:153448817-153448839 ACAGACCCTGGCCTGGGTCTCGG - Intronic
1200829784 Y:7679112-7679134 ACATATCCTGGCCCTGGCCCTGG + Intergenic
1201257538 Y:12124029-12124051 ATAGACCCTGCCCTTGGGCTAGG - Intergenic
1201525993 Y:14935208-14935230 GCTGCTTCTGCCCTTGGCCTAGG - Intergenic