ID: 1114614847

View in Genome Browser
Species Human (GRCh38)
Location 14:24062861-24062883
Sequence CAGGTTATTAAGGAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114614847 Original CRISPR CAGGTTATTAAGGAGGAGCA GGG (reversed) Intronic
901829187 1:11881714-11881736 CAGGGGAATAAGGAGGAGCCAGG + Intergenic
907136881 1:52148068-52148090 AAAGTTATTAACCAGGAGCATGG - Intronic
910160579 1:84268036-84268058 GAGGATATTGAGGAGAAGCAAGG - Intergenic
917072546 1:171168483-171168505 CAGAGTATTAAGAGGGAGCAAGG - Intergenic
919988975 1:202695839-202695861 CAGGTGATTAAAGAGGTGTAAGG - Intronic
920667813 1:207978542-207978564 CAGGCTTTTTAGGAGAAGCATGG + Intergenic
921187388 1:212682395-212682417 CAGGTTATTAAGGGAAATCAGGG + Intergenic
921334867 1:214075961-214075983 GAGGTGATTAGGGAGGAGGAGGG + Intergenic
922950546 1:229555307-229555329 CAGGTGCTTGAGGAGGAGCAGGG - Intronic
923481142 1:234385322-234385344 CAGGTGATAAAGCAGCAGCAGGG - Intergenic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1064283287 10:13970309-13970331 CAGGTGAAGAAGCAGGAGCAGGG + Intronic
1064970939 10:21066176-21066198 CAAGTTAGGAAGGAGAAGCAGGG - Intronic
1066156481 10:32683845-32683867 CTGCTTAGTAAGGAGTAGCAAGG + Intronic
1066468111 10:35670926-35670948 CAGGTGATTAAACATGAGCAAGG - Intergenic
1070555644 10:77525776-77525798 CATGTTAGTAACGAGGAGGAGGG - Intronic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1073559243 10:104482803-104482825 AAGGTCAAGAAGGAGGAGCAAGG - Intergenic
1074284445 10:112084853-112084875 TAGGTAATTAAGGAGGGGCAGGG + Intergenic
1082852806 11:57780404-57780426 CACTTTATCAAGAAGGAGCATGG + Intronic
1088466894 11:110149262-110149284 CAGGTTAGTGGGGATGAGCAGGG - Intronic
1089458078 11:118636972-118636994 AAGGTTCCTAAGGAGGAGCATGG - Intronic
1089909581 11:122083384-122083406 CAGGTTAACAGAGAGGAGCAGGG - Intergenic
1090524800 11:127521857-127521879 GAGTTTATTAAGGAGGACCGTGG - Intergenic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1097351401 12:58553209-58553231 AAGGGTAGGAAGGAGGAGCAGGG - Intronic
1100176751 12:92039315-92039337 CAGGTTATTAAAGTGAAACAAGG + Intronic
1100189092 12:92171563-92171585 CACATTATTAATAAGGAGCACGG + Intergenic
1101173220 12:102120850-102120872 CAGGTCATAAAGGGGGAGCCTGG + Intronic
1101297831 12:103443058-103443080 CAGGCTAGTAAGGAGGTGCATGG + Intronic
1101967676 12:109292174-109292196 CAGGTTACTGAACAGGAGCATGG - Intronic
1101984707 12:109436638-109436660 CAAGGTTTTAAGGATGAGCAGGG - Intronic
1104113796 12:125729349-125729371 CAGCTGATAAAGCAGGAGCAGGG + Intergenic
1106107611 13:26747060-26747082 CAGGTGTTTAAGCAGAAGCAAGG + Intergenic
1106798576 13:33232847-33232869 CAGGGAATTAGGGAGGAACAAGG - Intronic
1107335133 13:39346743-39346765 CAGGGTTTTAAGTAAGAGCATGG - Intronic
1109267488 13:60217795-60217817 CAGGTAGTTAAGCATGAGCAGGG - Intergenic
1111694144 13:91602018-91602040 GAAGTTAAGAAGGAGGAGCATGG + Intronic
1113149123 13:107242346-107242368 CAGGACATTGAGGAGGAGAAGGG - Intronic
1114397364 14:22377916-22377938 CATGATAATAAGGAGGAGAAGGG - Intergenic
1114614847 14:24062861-24062883 CAGGTTATTAAGGAGGAGCAGGG - Intronic
1114722044 14:24892809-24892831 GATGTTATCAAGCAGGAGCAGGG + Intronic
1117532875 14:56676250-56676272 CTGGTTATTAAGGTGGAGCTTGG + Intronic
1120030771 14:79638145-79638167 CAGGCTAGAAAGGAGGGGCATGG - Intronic
1121711532 14:96042353-96042375 CAAGTTATTGAGCAGGAGAATGG + Intronic
1122043693 14:99008449-99008471 CAGGTCCCTAAGGTGGAGCATGG + Intergenic
1126893591 15:53233939-53233961 CAGGATATTAGGCAGGAGGAGGG - Intergenic
1128038415 15:64547593-64547615 CAGGTTACTCAGGAGGATGATGG + Intronic
1128177934 15:65573143-65573165 CAGGTTTTCCATGAGGAGCAGGG - Intronic
1130569830 15:85032285-85032307 CAGGTTATTAATCAGGAAAAGGG - Intronic
1131870870 15:96763219-96763241 CAGGATATTAAAGATGAGAAAGG - Intergenic
1136550590 16:30980459-30980481 CAGGGTGTTAAGGAAGAGAACGG - Intronic
1137499833 16:49002121-49002143 CATGTTCTTAAGGATGAGTAAGG + Intergenic
1140823176 16:78681696-78681718 CAGGTAATTAACGAAGAGCTGGG - Intronic
1146373640 17:32280477-32280499 CAGGCTGTGAAGGAGGAGGAAGG + Intronic
1147186290 17:38715096-38715118 CAGGTTGTCTAGGAAGAGCATGG + Intronic
1147332724 17:39708318-39708340 CAGGATATCCAGGAGGTGCAGGG + Exonic
1150700664 17:67444313-67444335 CAAGTTATGAAGGAGGAATACGG + Intronic
1151808209 17:76419958-76419980 GAGGTGATGAAGGAGGGGCAGGG - Intronic
1153039683 18:800553-800575 CAGCTTATTAGGGAGGACAAAGG + Intronic
1154122474 18:11663127-11663149 CAGGTAACCAAGGAGGAGGAGGG + Intergenic
1155488530 18:26373232-26373254 TAGGGTAATAAGGTGGAGCAAGG - Intronic
1157475421 18:48020809-48020831 CAGGTTAGAAGGGAGGAGCGGGG - Intergenic
1157545430 18:48543181-48543203 CAGGTCATGAAGGAGGAGGCAGG + Intronic
1164479833 19:28602780-28602802 CAGGCGATTTAGGAGGAGAAGGG - Intergenic
1164656653 19:29926809-29926831 CAGGTCCTGAAGGAGGAGCAAGG + Intronic
1165297786 19:34941907-34941929 CAGTCTTTTAATGAGGAGCACGG - Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1168190207 19:54732831-54732853 CAGGAAACTAAGGAGGAACAAGG + Intronic
1168205119 19:54844733-54844755 CAGGAAACTAAGGAGGAACAAGG + Intronic
925571867 2:5321122-5321144 CAGGAGATGAAGGAGGAACAAGG - Intergenic
936502355 2:113076164-113076186 CAGGTGCTTAAGTAGTAGCAAGG + Intergenic
941013747 2:160331271-160331293 CAGGAAATTAAGGTGGAGCAGGG - Intronic
945496676 2:210515962-210515984 AAAGTCATTTAGGAGGAGCAGGG + Intronic
947168889 2:227290843-227290865 CAGGTTATTCAGAAGGTACAAGG + Exonic
947783642 2:232794140-232794162 CAGGTTCTTAAGAAGGAAAAGGG - Intronic
1170818593 20:19736453-19736475 AAGGTTATTAAGGCCGAGCACGG - Intergenic
1171018131 20:21560329-21560351 CAGATTCTTAAGAAGGACCAGGG - Intergenic
1171216272 20:23354793-23354815 CAGGTTGTGAGGGAGGAGGAGGG + Intergenic
1184306806 22:43608707-43608729 AAGGTGATTAAGGAGGTGGATGG - Intronic
949665105 3:6330437-6330459 CATATTTTTAAGGAGGAGCACGG - Intergenic
950138377 3:10599170-10599192 AAGGTTATTCAGCAGGGGCAGGG - Intronic
952346548 3:32493007-32493029 CATGGAATTAAGGAAGAGCAAGG - Intronic
953056942 3:39395605-39395627 CAGATTATGAGGGAGGAGGAAGG + Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
957672216 3:83319956-83319978 TAGGCTATTGATGAGGAGCAGGG + Intergenic
960775334 3:121244731-121244753 CAGGTTTTTTAGCAGAAGCATGG + Intronic
967022717 3:185536546-185536568 CAGGTTATTAAAGATGGGCAAGG - Intronic
969719878 4:8887753-8887775 GAGCTTCTTCAGGAGGAGCAGGG + Intergenic
970309796 4:14770020-14770042 AAGGTTAGAAAGGAGGTGCAGGG - Intergenic
970662133 4:18297172-18297194 CATCTTATTAGGGTGGAGCAAGG + Intergenic
974261920 4:59536272-59536294 CAGATAATTAAGGAAGAGCAAGG - Intergenic
977535185 4:98249238-98249260 CAGGTGGTTAAGGAGGAGTAGGG - Intergenic
979377023 4:119958774-119958796 CAGTTTAAAAAGGAGGAGCTGGG - Intergenic
979382410 4:120022655-120022677 CAGTTTAAAAAGGAGGAGCTGGG + Intergenic
981891308 4:149741386-149741408 CAGGTTACTAAGGAGATGTAGGG + Intergenic
983149573 4:164261579-164261601 AGGATGATTAAGGAGGAGCATGG - Intronic
983187341 4:164715103-164715125 CACGTTATTAAGCAGCAGGAAGG + Intergenic
986203094 5:5597584-5597606 CCAGTTATTAAAGAGAAGCAAGG - Intergenic
987691063 5:21267733-21267755 GAGGTTTTTAAGAAGGAGGAGGG + Intergenic
993480324 5:88416612-88416634 GAGGATATTAAGGAAAAGCATGG + Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
998250076 5:140546760-140546782 CAGTTAACTAAGGAGGGGCAGGG - Intronic
1000278199 5:159758236-159758258 CACGTTATTAAGTAGGAGAGAGG - Intergenic
1000383087 5:160646610-160646632 CTGTTTATTAAGGAGGAGGCTGG + Intronic
1000632302 5:163604799-163604821 TATGTTATTATGGAGGATCATGG - Intergenic
1001448199 5:171803584-171803606 CAGGTTCTTAAATAGGTGCATGG - Intergenic
1001706508 5:173744757-173744779 CCGGTCATTACGGAGGAGGAGGG - Intergenic
1004289039 6:14349992-14350014 CAGTTGATTAGGTAGGAGCAGGG + Intergenic
1005631697 6:27714098-27714120 CAGCTTATAAAGGATGAGGATGG + Intergenic
1006015663 6:31078727-31078749 CAGTTTCCTAAGGAGGAGCCTGG - Intergenic
1007167721 6:39840886-39840908 CAGGATGCTAAGGAGGAGGAAGG + Intronic
1007476287 6:42122059-42122081 CAGTTTATAAAGGAGAAGGATGG + Intronic
1008860361 6:56141800-56141822 CAGGTTACAAAGGAGAACCAGGG - Exonic
1011153996 6:84308724-84308746 CAGGTGTTTACAGAGGAGCAGGG - Intergenic
1012383344 6:98647112-98647134 TAGTTTATTAAGGCCGAGCATGG - Intergenic
1015118945 6:129680469-129680491 GAGGTTATTATTGAGGAGGAAGG - Intronic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1016314439 6:142770878-142770900 CATGTTATTCAGGAGCATCAGGG - Exonic
1016565506 6:145448448-145448470 CAGATTATTAAAGAAGAGAAAGG + Intergenic
1016574493 6:145553387-145553409 CACGCTACTGAGGAGGAGCATGG - Intronic
1018346443 6:162904102-162904124 GAGGTTCTGAAGGAGGAGGAAGG - Intronic
1019208035 6:170378955-170378977 CAGGCAAATCAGGAGGAGCAAGG + Intronic
1019844210 7:3480695-3480717 CAGTTTATTCAGGAATAGCAGGG - Intronic
1020461046 7:8430396-8430418 AAGGTTATGAGGGTGGAGCAGGG + Intergenic
1021032453 7:15754547-15754569 AAGGATAATAAGGAGGATCATGG - Intergenic
1021619330 7:22536103-22536125 CAGCTTTTAAAGAAGGAGCATGG - Intronic
1021919087 7:25465704-25465726 CAGTTTATTCAGTAAGAGCATGG - Intergenic
1022165157 7:27752271-27752293 CATCTCAGTAAGGAGGAGCAAGG + Intronic
1026180025 7:68030756-68030778 CTGGTTTTTAAAGATGAGCATGG + Intergenic
1026322592 7:69280549-69280571 CAGGTTATGGAAAAGGAGCAGGG - Intergenic
1026569656 7:71518165-71518187 GAGGGTTTTAAGCAGGAGCATGG + Intronic
1027224478 7:76235277-76235299 CAGGAGATGATGGAGGAGCAGGG + Exonic
1027448615 7:78303407-78303429 CAGATGATTCAGGAGGAGGAGGG - Intronic
1028301613 7:89207329-89207351 CAGGAGGTTAATGAGGAGCAAGG + Intronic
1028371930 7:90101487-90101509 CAGCTTTTAAAGAAGGAGCATGG + Intergenic
1028888554 7:95961358-95961380 AAGGTAATTAAGAAGGAGGATGG + Intronic
1030522733 7:110618416-110618438 CAGGGTAGTAGGGAGGACCATGG - Intergenic
1033757899 7:144410643-144410665 CATGTTATTAAGGTGGTGCAAGG + Intergenic
1034905660 7:154943334-154943356 CTGTTTATTAAAGATGAGCAGGG - Intronic
1035416296 7:158690579-158690601 CATGTTACTAAGGAGGAGTCTGG - Exonic
1035613590 8:986084-986106 CACGTTATTAGGGGGGAGTATGG + Intergenic
1036068861 8:5417825-5417847 CAGATTTTTAAGGAGGAGAACGG + Intergenic
1036655039 8:10672461-10672483 CAGGTTATGAGGGAGAGGCAAGG + Intronic
1038517677 8:28201227-28201249 CAGATCAGTTAGGAGGAGCAGGG - Intergenic
1042552721 8:70008508-70008530 AAGGATTTTAAGGAGGGGCAGGG + Intergenic
1043030420 8:75127605-75127627 TAGATTAGTATGGAGGAGCATGG - Intergenic
1046806073 8:118480331-118480353 CAGGATACTAAGGAGTAGCAAGG - Intronic
1047020925 8:120774412-120774434 GAGCTTTTTAAGGAGGAGGATGG + Intronic
1048435624 8:134414317-134414339 CAGGATAGGAAGCAGGAGCAAGG - Intergenic
1050483797 9:6113756-6113778 CAGGTCATGATGGAGAAGCAGGG + Intergenic
1052209985 9:25892642-25892664 CAGGTTATTAAGCAGGTGGTTGG + Intergenic
1053152762 9:35753393-35753415 CAGCTTAGTTAGGAGGACCAAGG - Exonic
1055002106 9:71463218-71463240 CATCTTATATAGGAGGAGCAGGG + Intergenic
1056624081 9:88239301-88239323 TAGTTTATTCAGGAGGTGCAGGG - Intergenic
1056730332 9:89160469-89160491 CAGGTTGTTAAAGAGGCGCAGGG - Intronic
1058606725 9:106731024-106731046 CAGGGTATTGGGAAGGAGCAGGG - Intergenic
1059985854 9:119819784-119819806 GAGGTTATTAAAGAAGTGCAAGG - Intergenic
1062266906 9:135690680-135690702 CCGGACATTAAGGAGGACCAAGG + Intergenic
1185827160 X:3262666-3262688 CAGGTGAGTAAGGAGGAGACTGG - Intergenic
1187395383 X:18914883-18914905 CAGGTAAGCGAGGAGGAGCAGGG + Intronic
1188209426 X:27404047-27404069 AAAGATATTAAGGAGTAGCAAGG + Intergenic
1189607551 X:42695803-42695825 TAGCTTATTAAGGAGGTGCAGGG + Intergenic
1189930759 X:46006717-46006739 CAGTTGATAAAGTAGGAGCAGGG - Intergenic
1194872631 X:99152229-99152251 CAGTTTCTTAAGCTGGAGCAGGG + Intergenic
1195389694 X:104348592-104348614 AAGGTTTTTAAGCAGGAGAATGG + Intergenic
1196215715 X:113049808-113049830 AAGGTTATGAAGGAAGAGAATGG + Intergenic
1197314021 X:124941725-124941747 CAAGTCATTAAAGAGGAGGATGG - Intronic
1197598567 X:128497925-128497947 TGGGTTTTTGAGGAGGAGCAGGG + Intergenic
1198414701 X:136408103-136408125 GAGCTTATAAAGGAGGGGCAGGG + Intronic
1201251758 Y:12065687-12065709 CAGGTGAGTAAGGAGGAGACTGG + Intergenic