ID: 1114615697

View in Genome Browser
Species Human (GRCh38)
Location 14:24067157-24067179
Sequence CTGAGAAGGACTAATACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114615697_1114615705 28 Left 1114615697 14:24067157-24067179 CCTGCAGTATTAGTCCTTCTCAG 0: 1
1: 0
2: 0
3: 18
4: 99
Right 1114615705 14:24067208-24067230 CTTTCTGGCCCCATGACCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 85
1114615697_1114615703 13 Left 1114615697 14:24067157-24067179 CCTGCAGTATTAGTCCTTCTCAG 0: 1
1: 0
2: 0
3: 18
4: 99
Right 1114615703 14:24067193-24067215 TAAACAAGTCATTTACTTTCTGG 0: 1
1: 0
2: 2
3: 33
4: 323
1114615697_1114615704 25 Left 1114615697 14:24067157-24067179 CCTGCAGTATTAGTCCTTCTCAG 0: 1
1: 0
2: 0
3: 18
4: 99
Right 1114615704 14:24067205-24067227 TTACTTTCTGGCCCCATGACCGG 0: 1
1: 0
2: 2
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114615697 Original CRISPR CTGAGAAGGACTAATACTGC AGG (reversed) Intronic
900839658 1:5038090-5038112 GTGAGAATGACTAATACAGATGG - Intergenic
902634655 1:17727174-17727196 CCGAGAGGGACTATTACTGCAGG - Intergenic
903765322 1:25730448-25730470 CTGAGAATGACAAATACTAGGGG + Intronic
906911030 1:49950981-49951003 CATAGAAAGACAAATACTGCAGG + Intronic
907207632 1:52787900-52787922 TTGAGAATGATTAATTCTGCTGG + Intronic
913351319 1:117863351-117863373 CTGACATGGAATAATACTGATGG + Intergenic
924155069 1:241167305-241167327 ATGAGAAGAACGAATACTGGAGG - Intronic
924657145 1:245983104-245983126 CTGAGAAGACCTCATACTGAAGG + Intronic
1063841623 10:10078721-10078743 CTGATAAGTACTAAAATTGCAGG + Intergenic
1068547215 10:58360942-58360964 CTCAGAAAGAATAATACTTCAGG - Intronic
1068562425 10:58530306-58530328 CTGAGGATGACTACTACTTCTGG + Intronic
1069125009 10:64619269-64619291 CAGAGAAGGGCTCCTACTGCTGG - Intergenic
1072703536 10:97662785-97662807 CTGAGAATGACTACAAATGCTGG - Intronic
1075168768 10:120093621-120093643 CAGAAAAAGACAAATACTGCAGG - Intergenic
1078907559 11:15701990-15702012 CTGAGCAGCACTCCTACTGCAGG + Intergenic
1079322126 11:19459872-19459894 CTTAGGATGATTAATACTGCAGG + Intronic
1082850717 11:57761962-57761984 CTGAGAAAGACAAATCCAGCAGG - Exonic
1082898871 11:58223988-58224010 CACAGAAAGACAAATACTGCAGG + Intergenic
1083488228 11:62996658-62996680 CTGCAAAGGACTAACTCTGCTGG + Intronic
1093510918 12:19927272-19927294 CATAGAAGGACAAATACTGCAGG - Intergenic
1094616464 12:32040773-32040795 CAGGGAAGGACACATACTGCAGG + Intergenic
1102827412 12:115961127-115961149 CTGAGAAGGAATCACAGTGCAGG + Exonic
1103995296 12:124825789-124825811 GACAGAAGGACAAATACTGCAGG + Intronic
1104590814 12:130083583-130083605 CTGAGAAGGTCTGAGAATGCTGG + Intergenic
1105755956 13:23464679-23464701 CAGAAAAGGACGAATACTGTAGG + Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1116630602 14:47326580-47326602 TTGAGAAGGAATAAAACTGAAGG - Intronic
1117891993 14:60432240-60432262 CTGAGAAGCAGTTATACTCCAGG + Intronic
1117908899 14:60617611-60617633 CTGGGAAGGACTAAAATTACAGG + Intergenic
1118426634 14:65671536-65671558 CTGATAAGGACTTAGACTGGGGG - Intronic
1119782704 14:77288273-77288295 CTGAAAATGACTAAAAATGCTGG - Intronic
1124057885 15:26259399-26259421 CACAGAAAGACAAATACTGCAGG + Intergenic
1125768823 15:42151974-42151996 CTGGGCAGGACTCATCCTGCAGG + Intronic
1130347123 15:83058002-83058024 CTGAGAAGAACTGGGACTGCTGG - Intronic
1131688850 15:94804714-94804736 CTTAGAAGGACTAATACAGTAGG - Intergenic
1131974432 15:97929970-97929992 CTGGGTAGGACTGAAACTGCAGG + Intergenic
1138831375 16:60379131-60379153 CTGACGAGGACTAATAATTCCGG + Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1150856393 17:68757262-68757284 CTTAGAAGGAATAAAACTACTGG - Intergenic
1153213669 18:2796274-2796296 CTGAGAATGCCTATTACTTCTGG - Intronic
1153683685 18:7524656-7524678 CTGAGAAAGGCAAATAATGCAGG - Intergenic
1153926622 18:9840194-9840216 CTGAGAATTACTACGACTGCAGG - Intronic
1154937212 18:21073338-21073360 CTGAGAAGCACTGATATGGCAGG + Intronic
1155277204 18:24199680-24199702 GAGAGAAGGACTATTACTGCAGG + Intronic
1156178422 18:34574470-34574492 CTAAGAAGGACAAACACTTCTGG - Intronic
1156671271 18:39472960-39472982 TTGAGAATGACTACTATTGCTGG + Intergenic
1165984993 19:39760438-39760460 CACAGAAGGACAAATACTGCAGG + Intergenic
1168086651 19:54052517-54052539 CTCAGAAAGACAAATTCTGCAGG - Intronic
926280849 2:11444584-11444606 CTGAGAAGGAATAATGGGGCGGG - Exonic
926401278 2:12499676-12499698 TTGAGATGGACAAATAATGCTGG - Intergenic
927289163 2:21388116-21388138 ATGAGAAGGAATAAAACTTCAGG + Intergenic
931017928 2:58007065-58007087 CTGAGAAGGAAGAATATTGATGG - Intronic
933202988 2:79471968-79471990 CTGAGAAGGATTAAGACTTTGGG - Intronic
933444379 2:82359879-82359901 CACAGAAAGACAAATACTGCAGG - Intergenic
938177332 2:129145525-129145547 CACAGAAAGACAAATACTGCAGG - Intergenic
940410777 2:153360767-153360789 CTTAGAAAGACTAAGTCTGCTGG - Intergenic
942109647 2:172667534-172667556 CTGGGAAGGACAAATCCTCCAGG + Intergenic
942991234 2:182205783-182205805 CTGAGAAGGATTAGTACTTAGGG - Intronic
948567471 2:238896082-238896104 CTGAGAAGGAGGAATCCTGCTGG - Intronic
1169488619 20:6053463-6053485 CTGGGCAGGGCTAATACTGGGGG - Intronic
1169975279 20:11318839-11318861 CAAAGAAGGACAAATACTGCAGG + Intergenic
1170238760 20:14138498-14138520 CACATAAGGACAAATACTGCAGG + Intronic
1173328578 20:42055485-42055507 CTTAGAAAAACAAATACTGCTGG - Intergenic
1174274594 20:49394581-49394603 CTGAGAAGTGCTAAGACTTCTGG - Intronic
1175726431 20:61321693-61321715 CTGAGAAGCACCAATTCTGCAGG - Intronic
1178028758 21:28499850-28499872 ATGAGAAGCAGTCATACTGCAGG + Intergenic
1178803526 21:35818983-35819005 CTGAGCAGGACTGAACCTGCAGG + Intronic
1179589802 21:42399309-42399331 CGGAGAAAGACAAATACTGCAGG + Intergenic
1179720432 21:43313388-43313410 TTGAGAACCACTGATACTGCGGG - Intergenic
1182161194 22:28123558-28123580 TTGAGAAGAACTGATACAGCGGG - Intronic
1183828901 22:40407796-40407818 CTCAGAAGGACGAGCACTGCTGG + Exonic
1184397787 22:44254900-44254922 CTGACAAGGGCAAATTCTGCAGG - Intronic
953700464 3:45191640-45191662 CTCAGAAGGACTACTAGTGCTGG - Intergenic
955913853 3:63886147-63886169 CACAGAAAGACAAATACTGCAGG + Intronic
956753332 3:72362518-72362540 CTGAGAAGAAATAAGACTACTGG + Intergenic
956768329 3:72503356-72503378 CTTAGTAGGACTATTTCTGCGGG - Intergenic
959174800 3:102893627-102893649 CATAGAAAGACAAATACTGCAGG + Intergenic
967084802 3:186084918-186084940 ATGAGAAGAACTAATACCTCTGG + Intronic
969414336 4:7048813-7048835 CAGAAAAGGACAAATCCTGCAGG - Intronic
970614100 4:17751723-17751745 CTGAGAAGGAATATTGCTCCAGG + Intronic
971571248 4:28213665-28213687 CTGAGAAGGAGCAATTTTGCAGG + Intergenic
974181176 4:58386482-58386504 CTAAGAAAGACTAAGTCTGCTGG + Intergenic
974882487 4:67776905-67776927 CTGAGACGGACTGAGACAGCTGG - Intergenic
976806171 4:89050028-89050050 CTGAGAAAGACAAATAGTACAGG + Intronic
977622009 4:99148543-99148565 TTGAAAGGGACTAATAATGCTGG + Intronic
980262879 4:130476941-130476963 CTGATAAGGGCTAATGCAGCTGG + Intergenic
987313061 5:16699134-16699156 GGGAGAAGGACTGATACTGGAGG + Intronic
990564130 5:57011986-57012008 GAGAGAAGGACTCATACTCCTGG + Intergenic
993086913 5:83374504-83374526 ATGAGAACGACTAATACAGTAGG + Intergenic
993093577 5:83456996-83457018 CACAGAAAGACAAATACTGCAGG + Intergenic
994906767 5:105849902-105849924 CTGAGAAGGACTCATCATTCTGG - Intergenic
1002788258 6:419954-419976 CACAGAAGGACAAATACTGCAGG - Intergenic
1003019148 6:2495298-2495320 CTGAAAACAACTAATACAGCAGG - Intergenic
1012512307 6:100016296-100016318 AAGAGAAGCACTAATACTGCAGG + Intergenic
1014199132 6:118589320-118589342 CTGATATAGACTAAAACTGCAGG + Intronic
1017663289 6:156694758-156694780 CACAGAAGGACAAATACTGTGGG + Intergenic
1018373450 6:163189073-163189095 CTGAGATGGAATGATACTGCAGG + Intronic
1021739580 7:23672503-23672525 TTGAAAGGGCCTAATACTGCAGG + Intergenic
1022481043 7:30743355-30743377 CAGGGAAGGACAAATACTGTAGG - Intronic
1023085946 7:36570256-36570278 CACAGAAGGACGAATACTGCCGG - Intronic
1023331153 7:39118178-39118200 CTGAGAAGGAGTCATTTTGCTGG - Intronic
1036775653 8:11611089-11611111 CAGAGAAAGACAAATATTGCAGG + Intergenic
1037622400 8:20576317-20576339 CACAGAAGGACAAATACTGTAGG - Intergenic
1041327785 8:56687557-56687579 CTGAGAAAGATTATTACTACTGG + Intergenic
1043088625 8:75869746-75869768 CTGAAAAGGACAAATAAAGCAGG - Intergenic
1043878051 8:85508847-85508869 CTGAGAAGTAATAATTATGCTGG - Intergenic
1044763725 8:95549491-95549513 CTAAGAAGGATGAATTCTGCTGG - Intergenic
1049807027 8:144545811-144545833 CTGAGAAGGACAAATGCGGCTGG + Intronic
1051945391 9:22563383-22563405 CACAGAAGGACAAATATTGCGGG + Intergenic
1053339405 9:37310208-37310230 CTGAAAGGGACTAATGATGCAGG - Intronic
1057439098 9:95069348-95069370 CTGAAAGGGACTTTTACTGCTGG - Intronic
1061757476 9:132825095-132825117 CTGAAAAGCACAAATACTACAGG + Intronic
1189315730 X:40054924-40054946 CTGATAAGGACTTTAACTGCAGG + Intronic
1193067399 X:77274759-77274781 CTGAGAAGCACACAGACTGCAGG + Intergenic
1198128972 X:133675276-133675298 CTGGGTAGGGCTAATTCTGCAGG - Intronic
1199010361 X:142750970-142750992 CACAGAAAGACAAATACTGCAGG - Intergenic