ID: 1114616988

View in Genome Browser
Species Human (GRCh38)
Location 14:24073546-24073568
Sequence AATACTCAAGGGCCAGCACC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114616988_1114616997 29 Left 1114616988 14:24073546-24073568 CCGGGTGCTGGCCCTTGAGTATT 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1114616997 14:24073598-24073620 CACGTGTTCGATGCCGAGGACGG 0: 1
1: 0
2: 0
3: 1
4: 30
1114616988_1114616995 25 Left 1114616988 14:24073546-24073568 CCGGGTGCTGGCCCTTGAGTATT 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1114616995 14:24073594-24073616 GTTCCACGTGTTCGATGCCGAGG 0: 1
1: 0
2: 0
3: 0
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114616988 Original CRISPR AATACTCAAGGGCCAGCACC CGG (reversed) Exonic
900320892 1:2083115-2083137 AACACTCTGGGGCCAGCAACAGG - Intronic
904969037 1:34404661-34404683 AAGACTGAGGGGCCAGCATCTGG + Intergenic
905640273 1:39584550-39584572 AAGACTGAAGGGCCTGCATCTGG - Intergenic
906707050 1:47902455-47902477 TATACTCTAAGGCCAGCACTGGG + Intronic
911446228 1:97996081-97996103 AAAACTCAAGGGGCAGAACATGG - Intergenic
914434803 1:147650354-147650376 AATGCATAAGGGCCAGCAACGGG + Intronic
918328006 1:183428482-183428504 AAGACTGAGGGGCCAGCATCTGG - Intergenic
920502561 1:206494443-206494465 AATGCTCATGGGCCAGCCCGGGG + Intronic
1063097643 10:2922446-2922468 CACACTCAAGAGCCAGCGCCTGG - Intergenic
1063912904 10:10850410-10850432 AATACTCAAGGGCCATGTCTTGG - Intergenic
1066620710 10:37346178-37346200 AATAATCAATGGCCTCCACCTGG - Intronic
1075382792 10:122032541-122032563 AGTACACAAGGGCCAGGACTGGG - Intronic
1076576728 10:131474443-131474465 AATGCTCGAGGGGCAGCAGCAGG + Intergenic
1080184178 11:29459809-29459831 AACATTCAAGGGCCAGCAATGGG + Intergenic
1080352938 11:31405817-31405839 AATATTAAATGGCCAGCATCTGG + Intronic
1084887809 11:72222519-72222541 AATACTCAAGAGCCTGGAACTGG + Intergenic
1088235510 11:107718850-107718872 GATACACAAGGGTCAGCAACAGG + Intronic
1097508534 12:60507078-60507100 AAAACTCAAGGTCCAGCCACTGG - Intergenic
1101031920 12:100668993-100669015 AATACTCCTGGGCAAGCTCCTGG + Intergenic
1102050103 12:109855982-109856004 ACTTGTCATGGGCCAGCACCAGG - Intronic
1102548844 12:113676179-113676201 CATCCTCAAAGTCCAGCACCAGG - Intergenic
1103418180 12:120758708-120758730 AAGACTCATGGGCCAGGGCCGGG - Intergenic
1110035292 13:70674597-70674619 TATACTCAAGGTCCAGCAAATGG - Intergenic
1113942246 13:114024460-114024482 ACCACTCAAGGGCCACAACCAGG + Intronic
1114616988 14:24073546-24073568 AATACTCAAGGGCCAGCACCCGG - Exonic
1115777380 14:36730875-36730897 AGTACTCAACGGCAAACACCAGG + Intronic
1117300878 14:54425931-54425953 AATACTCAAGTAACAGCCCCAGG + Exonic
1117563787 14:56972620-56972642 ACAACTCAAAGGCCAGGACCAGG - Intergenic
1118254919 14:64197148-64197170 AAGACACAAGGGACAGCAGCTGG - Intronic
1120656153 14:87192323-87192345 ATTACCCAAGGGCCAGTAGCAGG + Intergenic
1121211997 14:92214132-92214154 AATTCTTAAGGGAAAGCACCTGG - Intergenic
1202903900 14_GL000194v1_random:57796-57818 AATTCTCCAGAGCCAGCATCAGG + Intergenic
1127822217 15:62668487-62668509 AAAACTCAGTGGCCACCACCTGG + Intronic
1130197393 15:81793344-81793366 AATATACAAGGGCCAGAACCAGG - Intergenic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1135416883 16:22275158-22275180 AATACTCAGTGCCCAGCTCCAGG - Intronic
1135732747 16:24908163-24908185 AGTCCTCAAGGGGCAGCACTTGG - Intronic
1141578012 16:84977298-84977320 AATCCTCTAGGGCCAGCCCCTGG + Intronic
1142486266 17:249430-249452 AAGCCTCAAGGGCCAGTGCCAGG + Intronic
1142514177 17:416248-416270 AATACTCCAGTGCCAGCCACAGG + Intronic
1144733492 17:17541913-17541935 GATATTCAGGGGCCAGTACCAGG - Intronic
1147504236 17:40999496-40999518 AATACTGAAGGGACAGCTTCTGG + Exonic
1148149344 17:45387095-45387117 AACACGCACGGCCCAGCACCTGG - Intergenic
1154213969 18:12401934-12401956 AATACACAAGGCCCAGAAGCTGG - Intergenic
1157964570 18:52193303-52193325 AATACTCAAGCTACAGCTCCAGG + Intergenic
1160362881 18:78298677-78298699 AAAGCTCAAGGAGCAGCACCAGG + Intergenic
1160976132 19:1793545-1793567 ATTTCTCAAGGGCCAGACCCAGG + Intronic
1163521189 19:17793010-17793032 AATTCTGGAGGGCCAGTACCTGG + Intergenic
925784856 2:7422029-7422051 AATTCTCAAGAGCAAGGACCAGG - Intergenic
926019723 2:9484371-9484393 CTTACACAAGGGCCAGCACTTGG + Intronic
926075898 2:9942436-9942458 AAAGCTCATGGGCCAGCACAAGG - Intergenic
926913756 2:17874553-17874575 AATACTCAAGGGCCTTCAGAGGG + Intergenic
928976010 2:37087188-37087210 AGTACTCTATGTCCAGCACCAGG - Intronic
934502754 2:94872619-94872641 AATTCTCCAGAGCCAGCATCTGG - Intronic
934849136 2:97686067-97686089 AAGACTGAGGGGCCAGCATCTGG + Intergenic
934912590 2:98272962-98272984 AAGATTAAGGGGCCAGCACCTGG - Intronic
940345888 2:152628110-152628132 CATAGTCAAGAACCAGCACCAGG + Intronic
940778238 2:157906437-157906459 CATACTGAAGGACCAGCACAGGG - Intronic
941754092 2:169166119-169166141 AATACTCCAGTGTCAGCACCAGG + Intronic
945701820 2:213179820-213179842 ATTAGTCAAGGGTCAGCACAGGG + Intergenic
947914541 2:233822914-233822936 GAGAGTCAAGAGCCAGCACCTGG + Exonic
1169526337 20:6430240-6430262 AATACTCCAGGGCCAAGCCCTGG - Intergenic
1169982527 20:11402110-11402132 AAGATTGAGGGGCCAGCACCTGG - Intergenic
1172119045 20:32586955-32586977 ACTACCCAAAGGCCAGCCCCAGG + Intronic
1176623270 21:9072564-9072586 AATTCTCCAGAGCCAGCATCAGG + Intergenic
1179248653 21:39655228-39655250 AAGACTGAAGGCCCAGCTCCAGG + Intronic
1182074967 22:27489102-27489124 AATTCTAAAGGGGCAGCACAAGG + Intergenic
1185149724 22:49157227-49157249 AACACTGAAGGGCTAGGACCGGG - Intergenic
950180169 3:10906467-10906489 AATTCTGAAGATCCAGCACCAGG + Intronic
950808916 3:15632698-15632720 TAACCTCACGGGCCAGCACCTGG + Intronic
955375895 3:58397119-58397141 AATTCTCAAGGTCCAGCAGCCGG - Exonic
957572456 3:81965000-81965022 TATAGTCAAGGCCCAGAACCAGG - Intergenic
959823260 3:110762465-110762487 AATATCAAAGTGCCAGCACCTGG + Intergenic
960043879 3:113177953-113177975 CATACTCAAGTGCCAGGAACAGG + Intergenic
960703290 3:120458096-120458118 AATCCTGAAGAGGCAGCACCAGG + Intergenic
961094457 3:124142583-124142605 AATACTGTAGGGACAGCCCCAGG - Intronic
961461123 3:127050992-127051014 AACCCTCAAGGGCCCCCACCTGG - Intergenic
962198634 3:133383701-133383723 AATCCTCAAGGGACAGTCCCAGG - Intronic
962698300 3:137972546-137972568 CCTACTCAAGGGCCAGCAGAAGG + Intergenic
963124752 3:141805223-141805245 AATCCTCAAGGGCAAGGGCCAGG + Intronic
963615307 3:147529057-147529079 TATACTCAAGGGAAAGGACCAGG - Intergenic
964672069 3:159237762-159237784 ACTACTCAAGGACCTGAACCTGG - Intronic
965313755 3:167164573-167164595 AATATTCAATGGCCACCAGCTGG + Intergenic
966442178 3:179957859-179957881 AATACTGAATGGCCAGGACCAGG - Intronic
967425016 3:189316881-189316903 AATGCTCAAGAGCCAGCTCGGGG + Intronic
968427622 4:534131-534153 AAAGCTCAAGGGCCAGAAGCCGG + Intronic
968902737 4:3439053-3439075 CATCCTCAAGGGCCACCCCCAGG - Intronic
969509366 4:7608908-7608930 AACACACCAGGGCCAGCATCAGG + Intronic
972104418 4:35463630-35463652 AATACTCTAGGGCAAGAACCCGG + Intergenic
974517833 4:62940055-62940077 ATTACTCATAGGCCAGCACTTGG + Intergenic
979931731 4:126640498-126640520 AATACTCAAGACTCAGCACAGGG + Intergenic
980779081 4:137473806-137473828 AAAACTGAGGGGCCAGCATCGGG + Intergenic
984553088 4:181183564-181183586 AACACGCAAGGGACAGCTCCAGG + Intergenic
985130565 4:186734673-186734695 AAGACTGAGGGCCCAGCACCTGG + Intergenic
985708011 5:1412779-1412801 AATAATCAAAGGCCAGAGCCAGG + Intronic
986733650 5:10652784-10652806 GATACTCTGGGGCCAGCACAGGG + Intergenic
989647131 5:43647065-43647087 AAGAATTAAGGACCAGCACCAGG + Intronic
992113657 5:73519280-73519302 AATACCAAGGGGCCAGCATCTGG + Intergenic
993080021 5:83285063-83285085 AATAATCCTGGGCAAGCACCAGG - Intronic
997970064 5:138394009-138394031 AATATTCAATGGCCAGAACAAGG - Intronic
998729991 5:145063955-145063977 AGTAGTCAAGGGCCAGCAGTGGG - Intergenic
1001648500 5:173299144-173299166 GATGCTGAAGGGCCAGCCCCAGG + Intergenic
1003354812 6:5357776-5357798 AGTACTTAAGTGGCAGCACCAGG - Intronic
1005350670 6:24931883-24931905 AATACTCACTGACCACCACCTGG + Intronic
1006301798 6:33197586-33197608 GAAACTCAAGGGCCAGAACAGGG + Intronic
1007116174 6:39344910-39344932 AAATCTCATTGGCCAGCACCTGG - Intronic
1007192709 6:40033243-40033265 AAGACTCAAGTCCCAGAACCAGG - Intergenic
1007851240 6:44804590-44804612 ATTCCTCCAGGGCCAGCCCCAGG + Intergenic
1011247691 6:85336897-85336919 AGTACGCAAGGGCCAGATCCTGG + Intergenic
1015439885 6:133235563-133235585 CAAAATCAAGGGCCAGCATCTGG - Intergenic
1018683420 6:166283432-166283454 AATACTCAGGTGCCAGCATCTGG - Intergenic
1024964091 7:55006108-55006130 AATAATGCAGGGACAGCACCCGG - Intergenic
1029351366 7:100015466-100015488 AAAACTCAAGGGCAGGCGCCTGG + Intergenic
1029710419 7:102296134-102296156 AATAACCAAGGGACAGCCCCAGG - Intronic
1030608768 7:111666734-111666756 AACACACAAGGGCTAGCAGCAGG + Intergenic
1031398584 7:121303771-121303793 AAGCCTCAGGGCCCAGCACCGGG - Intergenic
1035031128 7:155861384-155861406 AAGGCCCCAGGGCCAGCACCAGG + Intergenic
1037627583 8:20621480-20621502 AGTACTCTGGGGCCAGCAACAGG + Intergenic
1038909363 8:31945488-31945510 AATTCTCAAGTGGCTGCACCTGG - Intronic
1040372785 8:46794086-46794108 AGGACTCAAGGGCCAGGAACAGG - Intergenic
1041897352 8:62940328-62940350 AATACTCCATGGACAGCACTAGG + Intronic
1042606878 8:70554551-70554573 AAAACTGAAGGTCCAGCATCTGG + Intergenic
1042769855 8:72367590-72367612 ACTACTCATGAGACAGCACCAGG - Intergenic
1044947003 8:97398679-97398701 AAGACCAAAGGGCCAGCATCTGG + Intergenic
1046363876 8:113199905-113199927 AATAATCAAGGCCCTGCACCTGG - Intronic
1054925200 9:70581851-70581873 AACAATCAAGGGCCAGCAGGTGG + Intronic
1056657878 9:88523878-88523900 AATTCTTAAAGGCCAGCCCCTGG - Intergenic
1057896137 9:98910246-98910268 GATACTCAAGGTTCACCACCTGG + Intergenic
1059679716 9:116574381-116574403 TATACTCAAAGGCCAGTGCCAGG + Intronic
1060936168 9:127517419-127517441 CAGACTCAAGGGCCAGCCCCAGG + Intronic
1062630676 9:137461783-137461805 AAGACTCCAGGGCCAGGACAAGG - Intronic
1062648826 9:137565059-137565081 ACTGCCCAAGGGCCAGCACTCGG - Intronic
1203746456 Un_GL000218v1:42991-43013 AATTCTCCAGAGCCAGCATCAGG + Intergenic
1201159788 Y:11158005-11158027 AATTCTCCAGAGCCAGCATCAGG + Intergenic
1202017554 Y:20426853-20426875 AAAACTCAAAGGCAAGCACAGGG + Intergenic