ID: 1114617081

View in Genome Browser
Species Human (GRCh38)
Location 14:24074087-24074109
Sequence CTGAAGAATGGGAAGACTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 262}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114617074_1114617081 17 Left 1114617074 14:24074047-24074069 CCAGATTGTGTCACAAACCAAGG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1114617081 14:24074087-24074109 CTGAAGAATGGGAAGACTGCGGG 0: 1
1: 0
2: 1
3: 27
4: 262
1114617069_1114617081 29 Left 1114617069 14:24074035-24074057 CCACCTCCATCCCCAGATTGTGT 0: 1
1: 0
2: 2
3: 31
4: 413
Right 1114617081 14:24074087-24074109 CTGAAGAATGGGAAGACTGCGGG 0: 1
1: 0
2: 1
3: 27
4: 262
1114617076_1114617081 0 Left 1114617076 14:24074064-24074086 CCAAGGTCACTAAGCCATTATTG 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1114617081 14:24074087-24074109 CTGAAGAATGGGAAGACTGCGGG 0: 1
1: 0
2: 1
3: 27
4: 262
1114617070_1114617081 26 Left 1114617070 14:24074038-24074060 CCTCCATCCCCAGATTGTGTCAC 0: 1
1: 0
2: 2
3: 19
4: 260
Right 1114617081 14:24074087-24074109 CTGAAGAATGGGAAGACTGCGGG 0: 1
1: 0
2: 1
3: 27
4: 262
1114617073_1114617081 18 Left 1114617073 14:24074046-24074068 CCCAGATTGTGTCACAAACCAAG 0: 1
1: 0
2: 0
3: 11
4: 147
Right 1114617081 14:24074087-24074109 CTGAAGAATGGGAAGACTGCGGG 0: 1
1: 0
2: 1
3: 27
4: 262
1114617071_1114617081 23 Left 1114617071 14:24074041-24074063 CCATCCCCAGATTGTGTCACAAA 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1114617081 14:24074087-24074109 CTGAAGAATGGGAAGACTGCGGG 0: 1
1: 0
2: 1
3: 27
4: 262
1114617072_1114617081 19 Left 1114617072 14:24074045-24074067 CCCCAGATTGTGTCACAAACCAA 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1114617081 14:24074087-24074109 CTGAAGAATGGGAAGACTGCGGG 0: 1
1: 0
2: 1
3: 27
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114617081 Original CRISPR CTGAAGAATGGGAAGACTGC GGG Exonic
900294387 1:1941602-1941624 ATGAAGACAGGGAAGACAGCGGG + Intronic
900684587 1:3939971-3939993 CTGCAGACTGGGAGGACTGCAGG + Intergenic
902258133 1:15204215-15204237 CTGAAGAGTGGGAGGACTGGGGG - Intronic
903554085 1:24180689-24180711 CTGGTGGATGGGAAGACTGAGGG - Intronic
903926102 1:26831809-26831831 CTGAAGAATGAGTAGAGGGCTGG - Intronic
904216166 1:28921654-28921676 ATCAAGACTGGAAAGACTGCAGG - Intronic
904262064 1:29293565-29293587 CAGAAGAATGGCATGAATGCGGG - Intronic
905917508 1:41695905-41695927 CTGATGAATGGGAAGAGCCCTGG + Intronic
905939139 1:41848997-41849019 CTGAAGAATGGGAAGAAAGGAGG - Intronic
907487651 1:54788454-54788476 CTCAGGAAGGTGAAGACTGCAGG - Intronic
909281219 1:73756116-73756138 CTGACGAATGTGAAGATTCCTGG - Intergenic
913135900 1:115888835-115888857 GTGTAGAATGGGAAGACTGCAGG - Intergenic
913219814 1:116650425-116650447 CTGAGGTATGAGAAGTCTGCTGG - Intronic
913314693 1:117539981-117540003 TTGAAGAATAGGCAGACAGCAGG + Intergenic
913665979 1:121049225-121049247 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914017377 1:143832501-143832523 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914215971 1:145628752-145628774 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914468540 1:147951384-147951406 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914655988 1:149741033-149741055 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
915339032 1:155166420-155166442 CGAAAGAATGGGAAGCCTGGAGG - Intergenic
915805303 1:158842452-158842474 CTGAAGACTGGGGAGACTCAAGG - Intronic
916797869 1:168184060-168184082 CTGAAGAGTGGCAAGAAAGCAGG + Exonic
917353939 1:174106526-174106548 ATTCAGAAAGGGAAGACTGCAGG - Intergenic
918341428 1:183570873-183570895 CAGAAGAATGGAAACAGTGCTGG - Intronic
919937297 1:202262873-202262895 GTGAGATATGGGAAGACTGCAGG - Intronic
920020326 1:202950894-202950916 CTGAACAAGGGGATGACTCCTGG + Intronic
920052162 1:203170860-203170882 CTGAAGACTGTGAAGAGGGCTGG - Intronic
920714609 1:208327819-208327841 CTGAAGAAGTGCAAGACTGGAGG - Intergenic
922601417 1:226857619-226857641 CTGAAGTATGGGCAGTCTGTGGG + Intergenic
1065045322 10:21742860-21742882 CGGAAGCATGGGAAGGCTGCAGG - Exonic
1065082272 10:22140313-22140335 CAGAGGAAAGGGAAGAGTGCAGG + Intergenic
1065263932 10:23955608-23955630 CTGCCCAATGGGAAGGCTGCGGG + Intronic
1065713186 10:28536322-28536344 CTTAAGGATGGGAAAAATGCAGG + Intronic
1067689587 10:48493287-48493309 ATGAAGACTGGGAGGACAGCAGG - Intronic
1069200793 10:65613276-65613298 CTGAACAAGGGGAAGTTTGCAGG - Intergenic
1069738154 10:70670881-70670903 CTGCAGAGTGGGAACCCTGCGGG - Intergenic
1071930516 10:90464564-90464586 CTGAAGAATAGGAAGAAAACAGG - Intergenic
1072294806 10:93998691-93998713 CTGCAGACTGGGAAGACTTGAGG - Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1073733798 10:106322855-106322877 TCTGAGAATGGGAAGACTGCAGG - Intergenic
1073744597 10:106451787-106451809 TTGTAGAATGGGAAGACTGAGGG + Intergenic
1074069804 10:110055055-110055077 TTTAAGAATGAGAAAACTGCTGG - Intronic
1074153248 10:110777265-110777287 CTAAGGAGTGGGAAGACAGCAGG + Intronic
1074739397 10:116470396-116470418 CTGAAGAATGGGCAGAGAGAAGG + Intronic
1075159778 10:120012750-120012772 TGGAGGAATGGGAAGAATGCTGG + Intergenic
1075249554 10:120853644-120853666 CTGAAGAAATGCAAGACTGGAGG + Intronic
1075510987 10:123072984-123073006 ATGAGGAATGGGAAGAGTGATGG - Intergenic
1076248498 10:128966342-128966364 CTGAAGAATGCTAACACAGCTGG - Intergenic
1078302815 11:10150455-10150477 CTGGAGAATGGGATTACTGATGG + Intronic
1078476141 11:11632194-11632216 CTGAAGAGTGGGGAGGCTTCTGG - Intergenic
1079354306 11:19717193-19717215 ATGAAGAGTGGGAAGACCGCAGG - Intronic
1081167379 11:39822722-39822744 CTGTAGAATGGCCACACTGCAGG + Intergenic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1083504500 11:63143256-63143278 ATGAAGAATGAGCTGACTGCAGG + Intronic
1083581962 11:63830722-63830744 CTGAAGCAGGGGCAGTCTGCTGG - Intergenic
1084967510 11:72752254-72752276 CTGCAGAATGGGGAAACTGCAGG + Intronic
1085217956 11:74848831-74848853 CTGAAGAATGAGACTACTGAGGG - Intronic
1086505239 11:87497665-87497687 CTGCAGGTTGTGAAGACTGCAGG - Intergenic
1088440039 11:109860114-109860136 CAGGAGAATGGAAAGAATGCTGG - Intergenic
1090487225 11:127124516-127124538 GTGAAGAATGGGAAGAGAGAAGG - Intergenic
1090879366 11:130820105-130820127 CTGCAGAATGGGATGGCTTCTGG + Intergenic
1091805670 12:3354274-3354296 TTGAAGAATGGAAAAGCTGCTGG - Intergenic
1092166246 12:6344057-6344079 CTAAAAAATGGGAAACCTGCTGG + Intergenic
1092955873 12:13549303-13549325 CTGAAGAAAGGGAAGCATGGGGG - Exonic
1093670694 12:21871543-21871565 CTCAAGAATGAGAAGACTATGGG - Intronic
1094044115 12:26148173-26148195 CAGGAGGATGGGAAGACAGCAGG - Intronic
1096862722 12:54541551-54541573 CTGAAGGAAGGGAAATCTGCTGG - Intronic
1099486307 12:83232969-83232991 CTGCAGTTTGGGAAGACTGTGGG + Intergenic
1099489120 12:83266752-83266774 CTAAACAATGGGTAGACAGCTGG - Intergenic
1100196406 12:92250959-92250981 ATGAAGAATGTGAAGAATGATGG + Intergenic
1101726546 12:107392955-107392977 GTGAAGGATGGGAAGGATGCAGG + Intronic
1102704694 12:114870828-114870850 CTGAGCAATGGGAAGACAGGAGG - Intergenic
1102780140 12:115557215-115557237 CTGAGGATTGGGTAGACTGATGG - Intergenic
1105300324 13:19128120-19128142 CTGATGGATGGAAACACTGCTGG + Intergenic
1107242755 13:38256952-38256974 CTGAAGAATGTGAAGAAAGTAGG + Intergenic
1107451335 13:40512778-40512800 CTGAAGAAGGGAAAGGGTGCAGG - Intergenic
1108405820 13:50100469-50100491 CAGAAGAATTGGACGAATGCAGG + Intronic
1108855064 13:54782683-54782705 CAGAAGCATGGGAAGACTTGAGG + Intergenic
1109338998 13:61030069-61030091 CTGAAAAATGGGAATATAGCAGG - Intergenic
1110142310 13:72145563-72145585 CTGAAGAATGAGAAAAATTCAGG + Intergenic
1110422183 13:75324335-75324357 GTGAAGACTTGGAAGACTGGAGG + Exonic
1114339599 14:21729354-21729376 ATGTAGCATGGGAAGACTGCAGG - Intergenic
1114351118 14:21852533-21852555 CTGAACAAGGGAAACACTGCAGG - Intergenic
1114355431 14:21903052-21903074 CTGAGCAATGGAAACACTGCAGG - Intergenic
1114617081 14:24074087-24074109 CTGAAGAATGGGAAGACTGCGGG + Exonic
1115535823 14:34372551-34372573 CTGTAGCATGGGAAGCCTGGAGG - Intronic
1116435564 14:44891970-44891992 CTGCTGAATGGGAAGTCTGGAGG + Intergenic
1117218127 14:53573328-53573350 ATGAAGAATGAGAAGAACGCTGG + Intergenic
1118744120 14:68761784-68761806 GAGAAGAATGGGCAGACTGGAGG - Intergenic
1118919203 14:70134382-70134404 CAAAGGAATGGGAAGAATGCAGG - Intronic
1120105588 14:80490581-80490603 CTGATGAATGGGCAGAGTCCTGG + Intronic
1120249827 14:82049834-82049856 GAGAGGAATGGGAAGACTGGTGG + Intergenic
1120663267 14:87275942-87275964 CTGCAGATTGGGATGATTGCTGG + Intergenic
1120816354 14:88863092-88863114 ATGGAGAATGGGAAGACAGGCGG - Intronic
1121007433 14:90499357-90499379 CTGCAGAAAGGGCAGCCTGCGGG + Intergenic
1121877344 14:97465384-97465406 CTGAACAAAGGTAAAACTGCTGG - Intergenic
1122225488 14:100274938-100274960 CTGTTAAATGGGATGACTGCAGG + Intronic
1123216592 14:106813826-106813848 CTGAGAAATGGGAAGACCACAGG + Intergenic
1123706001 15:22951556-22951578 CCGCAGAAAGGGCAGACTGCGGG - Intronic
1124686124 15:31783475-31783497 GTGAAGAATATGAAGACTACTGG - Intronic
1126507897 15:49429295-49429317 ATGAAGAATGGATAAACTGCTGG + Intronic
1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG + Intronic
1130935869 15:88469926-88469948 ATTAAGATGGGGAAGACTGCAGG + Intronic
1132306775 15:100820711-100820733 CCAGAGAATGGGAAAACTGCTGG + Intergenic
1133186532 16:4103229-4103251 CTGCAAGATGGGAAGACTGAGGG - Intronic
1134055080 16:11164958-11164980 TTGAGGAGTGGGAAGGCTGCAGG + Intronic
1141993325 16:87622419-87622441 CTGAGAAATGGGAACACAGCTGG - Intronic
1142590098 17:1000591-1000613 CTGAACAATGGGACGACCGGCGG - Intronic
1142968353 17:3594914-3594936 CTGAAGAACGGGAAGTCAGTGGG + Intronic
1144044962 17:11447216-11447238 CGGAAAACTGTGAAGACTGCAGG - Intronic
1144339165 17:14298360-14298382 CTGCGGAATGGGAAGACGGTTGG + Intergenic
1145830589 17:27913168-27913190 TTCAAGAATGGGAATGCTGCAGG + Intergenic
1146182578 17:30707584-30707606 ATGAAAGATGGGAAGACTGATGG - Intergenic
1147050749 17:37792847-37792869 CTTAGGAGTGGGAAGACTGCAGG - Intergenic
1147400424 17:40177587-40177609 CCGAAGAGTGGGCAGGCTGCGGG - Intronic
1148848548 17:50542897-50542919 CTGAAAAATGGGAGTAGTGCCGG - Exonic
1151454106 17:74215796-74215818 CTGAAGACTGGGATGACCGACGG - Intronic
1157616119 18:48988772-48988794 CTGAAGGCTGGGCAGGCTGCAGG - Intergenic
1157860738 18:51138145-51138167 CTGAAGAAATGTAAGGCTGCAGG - Intergenic
1158687748 18:59629940-59629962 CTGAAGAATGGACATACTGCAGG + Intronic
1158885251 18:61820798-61820820 CAGCAGAGTGGGAAGACTGGAGG + Intronic
1158957163 18:62551163-62551185 CTTAAGAATGGGTAGATTGAGGG + Intronic
1160293530 18:77617093-77617115 CTGAAAAGTGGGAAGAAGGCAGG - Intergenic
1160361948 18:78290769-78290791 CAGAATAGTGGGAAGACAGCGGG - Intergenic
1162976244 19:14208221-14208243 ATGAAAGATGGGAAGACTGATGG + Intergenic
1163049767 19:14673886-14673908 ATGAAGACTGGGAAGGCTGAGGG - Intronic
1165176621 19:33935120-33935142 CTGAAGCCTGAGAAAACTGCAGG - Intergenic
1167742971 19:51335523-51335545 ATGAGGATGGGGAAGACTGCAGG + Intronic
1168349240 19:55666639-55666661 CTGTAGAATGGGAAGAACCCTGG - Intronic
925162418 2:1695171-1695193 CTGGAGCCTGGGAAGACAGCAGG + Intronic
926025097 2:9535229-9535251 CTGAAAAATGAGAAGACTCTGGG - Intronic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927865197 2:26583578-26583600 CTGAGGAATGGGCACACAGCTGG - Intronic
928436052 2:31255112-31255134 CTGGAGACTGGGCAGCCTGCAGG - Intronic
928877235 2:36054210-36054232 CCGAGGAATGGCAAGGCTGCTGG + Intergenic
929694798 2:44105345-44105367 CTGAGGAATGGAGAGACTCCTGG - Intergenic
932304156 2:70689871-70689893 CTCAAGTTTGGGGAGACTGCAGG + Intronic
935788192 2:106568010-106568032 CAGAATAATGGGAAAGCTGCTGG + Intergenic
937020312 2:118644520-118644542 CCGGAGTATGGGAAGACAGCAGG - Intergenic
938772601 2:134513200-134513222 CTGGAGACAGGGAAGACTGTAGG + Intronic
938925752 2:136040376-136040398 TTGAAGGATGGGAAGACTATGGG + Intergenic
939202992 2:139062665-139062687 CTGAAGAAGGGGAAGTCTTCTGG - Intergenic
939258146 2:139771665-139771687 CTGAAGGCTGGGAAGTCTGAAGG - Intergenic
940361131 2:152797366-152797388 CTGAATGATGGGAAGAATTCTGG + Intergenic
941169947 2:162124561-162124583 CTGATGGATGGGAAGACTGGAGG - Intergenic
941203109 2:162539035-162539057 CTGAAGAAGCTGAAGACTGAAGG - Intronic
942408458 2:175681253-175681275 CTGAAGGATGTGAAGCCTGCCGG - Intergenic
945638995 2:212398539-212398561 GTTAAGAATGGCAAGACTGCAGG + Intronic
946628385 2:221639946-221639968 ATGAAGAATGAGTAGACTGGTGG - Intergenic
947629371 2:231642003-231642025 AAGAAGAATGAGAAGGCTGCCGG - Intergenic
948234418 2:236377454-236377476 CTGATGGAAGGGCAGACTGCAGG - Intronic
948955592 2:241287922-241287944 CTGTAGAATGTGAAGACGGGAGG + Intronic
1169252104 20:4068761-4068783 CTGCAGGAAGGGAAGCCTGCAGG + Intergenic
1170601463 20:17844505-17844527 ATGAAGAGTGCAAAGACTGCTGG - Intergenic
1174290075 20:49502086-49502108 CTGACCAATGGGATGAATGCAGG + Intergenic
1177595731 21:23240037-23240059 CAGAAGAATAGCAAGTCTGCTGG + Intergenic
1180578317 22:16802782-16802804 AGGAAGACTGGGATGACTGCTGG - Intronic
1180821110 22:18828469-18828491 CTGAGGTATGAGAAGTCTGCTGG - Intergenic
1181191868 22:21147576-21147598 CTGAGGTATGAGAAGTCTGCTGG + Intergenic
1181207328 22:21262934-21262956 CTGAGGTATGAGAAGTCTGCTGG - Intergenic
1181486242 22:23233479-23233501 CTGAAGAATGTGAAGACCCCAGG - Intronic
1181997590 22:26894881-26894903 AGGAAGAAGGGGAAGACTGGAGG + Intergenic
1183754065 22:39742628-39742650 TTGAAGAATGGCAAGAAAGCTGG - Intergenic
1184171333 22:42761505-42761527 CTGAGGAGTGGGGAGGCTGCTGG + Intergenic
1184649296 22:45912392-45912414 CTGGAGGATGAGAAGTCTGCAGG + Intergenic
1203219590 22_KI270731v1_random:32482-32504 CTGAGGTATGAGAAGTCTGCTGG + Intergenic
1203271235 22_KI270734v1_random:54345-54367 CTGAGGTATGAGAAGTCTGCTGG - Intergenic
949923350 3:9021749-9021771 GTGAAGAATGGGCACCCTGCAGG + Intronic
952131664 3:30371067-30371089 CGGAAGAATTGGGAGAATGCAGG - Intergenic
952357936 3:32601961-32601983 CTGAACAAGGGGAAGACAGCAGG - Intergenic
953366457 3:42349759-42349781 CTGTCGAATGTGCAGACTGCAGG + Intergenic
953480766 3:43249922-43249944 CAGAAAAATGGGAAGACTTCAGG - Intergenic
955055049 3:55447258-55447280 CTGAAGGAAGGGAAGCCTGGGGG - Intergenic
955055768 3:55454781-55454803 CTGGACAATGGGCAGACAGCTGG + Intergenic
955215643 3:56983099-56983121 GTCAGAAATGGGAAGACTGCTGG + Intronic
956876961 3:73473433-73473455 CAGAGGAATGGGAAGATTGTTGG + Intronic
958574431 3:95929636-95929658 GGGAAAAATGGGATGACTGCAGG - Intergenic
958653177 3:96964216-96964238 CTGCAGAATGGCAAGACTACTGG - Intronic
961706340 3:128788914-128788936 ATGAAGAAGGTGATGACTGCAGG + Intronic
962040271 3:131699925-131699947 CTGAAGCATGGGAACACAGCAGG - Exonic
962808151 3:138941228-138941250 CTGCAGAATGGGGACACTGCAGG + Intergenic
962902361 3:139772461-139772483 GTTAAGGATGAGAAGACTGCTGG + Intergenic
964950733 3:162289268-162289290 CTACAGAATGAGAAGACTGTAGG - Intergenic
965541827 3:169878979-169879001 CTGCAGCAAGGGAAGACGGCTGG - Intergenic
965907815 3:173731291-173731313 CTGAAGAATGGAAAGAAAGATGG + Intronic
967101484 3:186219654-186219676 GTGAATGATGGGAAGACTGGAGG + Intronic
967501839 3:190206451-190206473 CTGAAGATTTGAAAGAGTGCAGG - Intergenic
969095985 4:4733312-4733334 CTAAAGAATGGGAAGGATCCAGG - Intergenic
970418627 4:15883634-15883656 CTGCAGAATGGCCAGCCTGCTGG - Intergenic
971747967 4:30609855-30609877 CTGAAGACTGGTAATAATGCTGG + Intergenic
971813632 4:31459975-31459997 CTGATGAATGTTAAGACTGGAGG + Intergenic
973269826 4:48251226-48251248 TTGAAGAATAGGAAGAAGGCTGG - Intronic
975804750 4:78100127-78100149 CTTAAAATTGGAAAGACTGCAGG + Intronic
977836359 4:101649906-101649928 CTGAAGAATGGAAAGACAAGAGG - Intronic
979407384 4:120329857-120329879 ATGAAAAATGGAAGGACTGCTGG + Intergenic
981075460 4:140586891-140586913 CTGAACAAAGGGAAGAATGGAGG + Intergenic
981787093 4:148491767-148491789 CTGAGGAATTGGAAGAATGAAGG - Intergenic
984008985 4:174347941-174347963 CTGCAGAATGCAAAGATTGCTGG + Intergenic
984023984 4:174521738-174521760 CGAAAGAAAGGCAAGACTGCTGG - Intronic
984608920 4:181816396-181816418 CTGAAGACTGTCAAGACAGCAGG - Intergenic
985044112 4:185923042-185923064 CTGTAGAATGGGAAGAATACTGG + Intronic
985628344 5:1001747-1001769 CTGGAGAAGGGGAAGCCCGCGGG + Intergenic
988374213 5:30412971-30412993 CTGAAGAAAGAGAAGATTCCGGG - Intergenic
990011097 5:50999198-50999220 ATGAAGAATGGGAACACAGGTGG - Intergenic
990347897 5:54887041-54887063 GTGAAGCTTGGGAAGTCTGCTGG + Intergenic
991140761 5:63239507-63239529 CTGAGGGATGGGTAGTCTGCGGG + Intergenic
991498050 5:67247386-67247408 AGGAAGCCTGGGAAGACTGCTGG + Intergenic
993424175 5:87741788-87741810 TTGAAGCATGGTTAGACTGCTGG - Intergenic
994028064 5:95107967-95107989 CTTCAGAATGGTGAGACTGCTGG - Intronic
995164888 5:109027726-109027748 CTGCAGCCTGGGCAGACTGCTGG + Intronic
997359639 5:133286651-133286673 CTGAAGCAAGGTAGGACTGCAGG + Intronic
998904669 5:146891977-146891999 TTGAAGGATGGGAAGACTCATGG + Intronic
1000182468 5:158824784-158824806 TTTAAGTATGGGAAGACTGTGGG - Intronic
1000376180 5:160584192-160584214 CTGTGGATTGGGAAGACTGTGGG + Intronic
1002663957 5:180809714-180809736 CTGAGAAATGGGAACACTGTGGG - Exonic
1004164031 6:13239940-13239962 CTGAAAAATGTACAGACTGCCGG - Intronic
1005858891 6:29886474-29886496 CTGAAGGATGAGAAGAATGGAGG + Intergenic
1006807011 6:36795033-36795055 CTGCAAGATGGGGAGACTGCTGG + Intronic
1007208227 6:40170008-40170030 CTGAGGTATGGGATGCCTGCGGG + Intergenic
1007986861 6:46215959-46215981 CTGAAGAATGGAAACAGTGAAGG + Intergenic
1009779156 6:68246887-68246909 TTGAAGAATAGGAAGGATGCTGG - Intergenic
1010087539 6:71938234-71938256 CTCTAGCATGGGAAGACTGCAGG - Intronic
1010463145 6:76135904-76135926 AGGAAGGATGGGAAGCCTGCAGG + Intergenic
1010648921 6:78427586-78427608 CTGAGGAATGCAAAGACAGCTGG + Intergenic
1011191894 6:84738163-84738185 CTGAAGAAAGGGTGGACTGGGGG + Intronic
1011440693 6:87383916-87383938 CTGAAGAAAAGGAAGACCTCAGG + Intronic
1011855101 6:91679787-91679809 TTGAAGACTGAGAAGACTGTGGG + Intergenic
1012042128 6:94220501-94220523 CTCAAGAATGAGAAGAGTGATGG + Intergenic
1013620207 6:111880389-111880411 CTCAGGAATGGGAAGATTGATGG + Intergenic
1013963608 6:115929304-115929326 AGGAAGAATGGGAGGACTTCTGG + Intergenic
1014457196 6:121649541-121649563 ATGAAGAATGAGAAGACCACAGG + Intergenic
1015780453 6:136860343-136860365 CACAAAAATGTGAAGACTGCTGG - Intronic
1015877037 6:137833202-137833224 CTGAAAAATGAAAAGGCTGCTGG + Intergenic
1015928841 6:138336370-138336392 CTGATGCACGGGAACACTGCGGG - Exonic
1016110890 6:140221734-140221756 TGGAAGAAAGGGAAGACAGCTGG - Intergenic
1016367277 6:143333177-143333199 CTGAAGCATGGGGAGAGTGAGGG + Intronic
1016893683 6:149032331-149032353 GGGAAGACTGGGAAGACAGCAGG - Intronic
1020421336 7:8009094-8009116 CTGAAGAAATGGATCACTGCTGG + Intronic
1020749658 7:12124250-12124272 CTGAGCACTGGGAAGAATGCAGG - Intergenic
1021048541 7:15953805-15953827 CTGAGAAATGGGGAGACTACTGG + Intergenic
1022323396 7:29308218-29308240 CTGAGGAATGGAAAGACAGCTGG - Intronic
1023524132 7:41081172-41081194 TTGAAGGATGGGAGGAATGCTGG + Intergenic
1024278501 7:47698437-47698459 CAGAAGAGTGGGAAGACAGAAGG + Intronic
1024404120 7:48958390-48958412 GTGCAGAAGGGGAACACTGCTGG + Intergenic
1026431596 7:70352900-70352922 GCTAAGAATGAGAAGACTGCTGG + Intronic
1027694373 7:81390875-81390897 CAGCAGTATGGGAAGAATGCAGG - Intergenic
1027948421 7:84780607-84780629 CTGCAGTAGGGGAAGAGTGCTGG + Intergenic
1027998213 7:85454528-85454550 CTGAACAATAGGAAGGCTGGGGG - Intergenic
1028384842 7:90243589-90243611 CTGCAGAATGGCCAGCCTGCAGG - Intergenic
1030110997 7:106026855-106026877 CTGGAGAATGGGAAGGGTGGGGG + Intronic
1032883577 7:136115284-136115306 CTGCAGATTGCGAAGACTGTGGG + Intergenic
1034980356 7:155471827-155471849 CTGAAGAATGGGATGACATCAGG + Intergenic
1035336702 7:158133921-158133943 CTGAAGACAGGGAAGACTCAGGG + Exonic
1035850869 8:2918181-2918203 TTGAAGAATGAGGAAACTGCTGG - Intergenic
1035998488 8:4575476-4575498 CTGAAGAAAAGGAATAATGCAGG + Intronic
1036154720 8:6330601-6330623 CTGAATGATGATAAGACTGCTGG - Intergenic
1036731310 8:11267885-11267907 CAGAAGGATGGGAAGACTTAAGG + Intergenic
1037506682 8:19537592-19537614 CTACAGGATGGGAAGCCTGCAGG + Intronic
1037908073 8:22727189-22727211 CTGAAGAAAGGGAAGATTCAGGG - Exonic
1038840204 8:31177720-31177742 GTGAAGAATGGGAGCACGGCTGG + Intergenic
1038973093 8:32659717-32659739 ATGAAGACTGGGGAGACAGCTGG - Intronic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1041191951 8:55363748-55363770 CTGCAGAGGGGGAAGAGTGCAGG + Intronic
1042848546 8:73192382-73192404 CTGAAAAATGGGAAAATGGCTGG + Intergenic
1044096804 8:88076871-88076893 CTGAAGAATGGGAGGAAATCTGG + Intronic
1045335293 8:101196885-101196907 CTCAAAAAGGGAAAGACTGCAGG + Intronic
1045439178 8:102192855-102192877 GTGTAGAAAGGGAAGAGTGCTGG - Intergenic
1047512830 8:125528789-125528811 TGGAAGCCTGGGAAGACTGCTGG - Intergenic
1047777452 8:128084765-128084787 CTGAATAATGGGAGCAATGCTGG + Intergenic
1047882847 8:129215651-129215673 CTGAAGAACCGAGAGACTGCTGG - Intergenic
1049126612 8:140794955-140794977 CTGAACAATGGGAAGTATGCAGG - Intronic
1049214061 8:141399573-141399595 CTGGAGAATGGGGAGCCTGGGGG + Intronic
1053616747 9:39775239-39775261 CTCAAGAATGCGATGTCTGCCGG + Intergenic
1054236770 9:62567144-62567166 CTCAAGAATGCGATGTCTGCCGG - Intergenic
1054267421 9:62932199-62932221 CTCAAGAATGCGATGTCTGCCGG - Intergenic
1054771317 9:69086732-69086754 GTGAAGAATGGGATCATTGCAGG - Intronic
1055481213 9:76710734-76710756 CTGCAGAATGAGAAGATTGCTGG + Exonic
1055761375 9:79612300-79612322 CTTAAGACTTAGAAGACTGCAGG + Intronic
1057714406 9:97479588-97479610 TTGACAAATGGGAAGACTGTTGG + Intronic
1058375676 9:104318310-104318332 CTTAATAATGCTAAGACTGCAGG + Intergenic
1059560505 9:115330181-115330203 CTCAAGAATTTAAAGACTGCAGG - Intronic
1059764819 9:117374142-117374164 CTGGAAAATGGGAAGAATCCAGG - Intronic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060752373 9:126181767-126181789 CTGAACAATGGAAAGAAGGCTGG - Intergenic
1191159331 X:57311575-57311597 CGGAGGAATGGGAAGACTTGGGG - Intronic
1191991896 X:67046802-67046824 CTGAAAAATGGGAATACTAGTGG + Intergenic
1193726129 X:85041511-85041533 CTGAGGAATGGACGGACTGCAGG - Intronic
1194024903 X:88739342-88739364 CTGAAGAATGGTACAACTACTGG - Intergenic
1196053839 X:111333916-111333938 CTGAGAAGTGGGGAGACTGCAGG - Intronic
1199254507 X:145703330-145703352 CTGAAGACTGGGAACAAAGCAGG + Intergenic
1200388550 X:155918463-155918485 CTGCAGATTGCGAAGACTGTGGG + Intronic