ID: 1114617463

View in Genome Browser
Species Human (GRCh38)
Location 14:24075883-24075905
Sequence CACGGTAAAGACTCAGAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114617456_1114617463 17 Left 1114617456 14:24075843-24075865 CCTTCCTGGATTACATCATGGGT 0: 1
1: 0
2: 2
3: 11
4: 127
Right 1114617463 14:24075883-24075905 CACGGTAAAGACTCAGAGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 141
1114617458_1114617463 13 Left 1114617458 14:24075847-24075869 CCTGGATTACATCATGGGTGGCT 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1114617463 14:24075883-24075905 CACGGTAAAGACTCAGAGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114617463 Original CRISPR CACGGTAAAGACTCAGAGGG AGG Exonic