ID: 1114617463

View in Genome Browser
Species Human (GRCh38)
Location 14:24075883-24075905
Sequence CACGGTAAAGACTCAGAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114617458_1114617463 13 Left 1114617458 14:24075847-24075869 CCTGGATTACATCATGGGTGGCT 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1114617463 14:24075883-24075905 CACGGTAAAGACTCAGAGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 141
1114617456_1114617463 17 Left 1114617456 14:24075843-24075865 CCTTCCTGGATTACATCATGGGT 0: 1
1: 0
2: 2
3: 11
4: 127
Right 1114617463 14:24075883-24075905 CACGGTAAAGACTCAGAGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114617463 Original CRISPR CACGGTAAAGACTCAGAGGG AGG Exonic
903013716 1:20348452-20348474 CACAGTGCAGACTCAGAGAGTGG - Intronic
903608169 1:24590232-24590254 CACGGCAAACACTCAAATGGTGG + Intronic
904671799 1:32171592-32171614 CTGGGCAAAGAGTCAGAGGGAGG - Exonic
904703900 1:32376340-32376362 CAGAGTAGAGACTCTGAGGGAGG - Exonic
907293433 1:53433421-53433443 GAGGGTAGAGACACAGAGGGCGG - Intergenic
908149092 1:61281337-61281359 CACAGTAAGGACTCAAAGGAAGG + Intronic
912741172 1:112198926-112198948 GACAGTGGAGACTCAGAGGGTGG - Intergenic
914446644 1:147756536-147756558 GAGGGTAAAGGCTCAGAAGGAGG - Exonic
916413002 1:164565508-164565530 CAAGTTGAAGACTAAGAGGGAGG - Intronic
917166691 1:172120358-172120380 CATGGGAGAGACTCAGTGGGAGG - Intronic
918371533 1:183866533-183866555 CACGGGAAAGCCTCTGAGGCAGG + Intronic
920298880 1:204976381-204976403 CACAGTAAAGGCACAGAGGCAGG + Intronic
923921147 1:238565622-238565644 CCCAGTGAAGACTCAGAGGATGG - Intergenic
1065889427 10:30108511-30108533 CACAGTACACACTCAGAGTGAGG + Intronic
1068550930 10:58407186-58407208 CAGAGTAAAGACTCAGAAGTGGG - Intergenic
1070847516 10:79535520-79535542 CTCAGTAAAGACCCGGAGGGAGG - Intergenic
1070926268 10:80224620-80224642 TTCAGTAAAGACCCAGAGGGAGG + Intergenic
1073402390 10:103269128-103269150 CATGATAAAAATTCAGAGGGTGG - Intergenic
1084908800 11:72370822-72370844 CAGGGTAGAGAAGCAGAGGGAGG - Intronic
1088320732 11:108552302-108552324 CACGGCCAAGACTCAGGGAGGGG + Intronic
1088553709 11:111039847-111039869 CACTGAAAAGTCTCAGAGAGAGG + Intergenic
1088765599 11:112972929-112972951 CACGGAAAAGAGCCAGAGGGAGG + Intronic
1089411008 11:118242872-118242894 CAGGGCAAAAATTCAGAGGGAGG + Intronic
1094614366 12:32022814-32022836 CCCTGTAAAGAGACAGAGGGAGG - Intergenic
1096367102 12:51037310-51037332 CAAGAAAAAGACTCTGAGGGAGG + Intergenic
1098174224 12:67774328-67774350 CTCAGTACAGACCCAGAGGGAGG + Intergenic
1098982662 12:76974255-76974277 AACAATAAACACTCAGAGGGAGG - Intergenic
1099325335 12:81208112-81208134 CACTGTAAAGATTCAGAGGTGGG + Intronic
1101790750 12:107925166-107925188 CACTGTAAAGTCTAAGAGTGTGG - Intergenic
1102721704 12:115022195-115022217 CACAGTGAAGACTCAGTGGAGGG - Intergenic
1102996882 12:117358330-117358352 CACGGAGAAGAGTGAGAGGGCGG - Intronic
1103420161 12:120774272-120774294 CATGGGAAAGAGTAAGAGGGAGG - Intronic
1105991821 13:25629719-25629741 CACAGTAAAAAGGCAGAGGGTGG - Intronic
1106438929 13:29748316-29748338 CACGGTGTAGAGTCAGAGGGAGG - Intergenic
1107216844 13:37931651-37931673 GAGGGTGAAGACTAAGAGGGAGG - Intergenic
1109737204 13:66501898-66501920 AACAGAAAAGACTAAGAGGGTGG + Intronic
1110496657 13:76175479-76175501 CATGGGAATGACTCAGTGGGAGG - Intergenic
1110953450 13:81522749-81522771 CCCCGTAAAGAGACAGAGGGAGG + Intergenic
1114617463 14:24075883-24075905 CACGGTAAAGACTCAGAGGGAGG + Exonic
1115307047 14:31944308-31944330 CATGGTAAACACTTGGAGGGAGG - Intergenic
1116080109 14:40161439-40161461 CATGAAAAAGACTCAGTGGGAGG + Intergenic
1121501249 14:94440123-94440145 CATGACAAAGACTCAGAGGCAGG - Intergenic
1121519672 14:94577397-94577419 CACAATAAAGACACACAGGGAGG - Intronic
1125976527 15:43957900-43957922 CACAGTAAAGACTCAGTAAGTGG - Intronic
1127784238 15:62342138-62342160 CACGGTACAGACTAAGACAGTGG + Intergenic
1128772590 15:70293235-70293257 CACGGAAAAGAATCAAAAGGAGG + Intergenic
1129003567 15:72353757-72353779 CAGAGTAAAGACTCAGGGAGTGG + Intronic
1130742046 15:86611507-86611529 CAGGAGAAAGACTTAGAGGGAGG + Intronic
1135645852 16:24161382-24161404 CATGGAAAAGAATCAGAAGGGGG + Intronic
1138769909 16:59651052-59651074 CACGGGAGAAACTCAGTGGGAGG - Intergenic
1139240642 16:65388611-65388633 CATGGTAGAGACTCAGTGGGAGG - Intergenic
1140997179 16:80272366-80272388 CACGGGAGAGACCCAGTGGGAGG - Intergenic
1141030386 16:80582627-80582649 CACATTAGAGACTCAGAAGGAGG + Intergenic
1143163347 17:4885462-4885484 CACTGTGAAGACACAGAGGGAGG - Exonic
1144936454 17:18902909-18902931 CTCGGTAAAGACTGAGTGGAGGG - Intronic
1150007639 17:61479576-61479598 CAGGAGAAAGAATCAGAGGGTGG + Intronic
1150860653 17:68797127-68797149 GAGGGTAGAGACACAGAGGGTGG + Intergenic
1151803457 17:76391211-76391233 CAGGGCTCAGACTCAGAGGGCGG - Exonic
1154105289 18:11517607-11517629 CACAATAAAGACTCAGAGCCAGG - Intergenic
1155613490 18:27695410-27695432 CCCGGTACAGAGACAGAGGGAGG - Intergenic
1156779854 18:40838081-40838103 CAGGGAGAATACTCAGAGGGCGG - Intergenic
1158626359 18:59075131-59075153 CAGGGGAAAGACCCAGTGGGAGG + Intergenic
1160094820 18:75861774-75861796 CAGGGTAATGAGTCAGAGGTGGG + Intergenic
1160318558 18:77869408-77869430 CATGGGAAATACGCAGAGGGTGG + Intergenic
1162193775 19:8967727-8967749 CAGGGAAAGGATTCAGAGGGAGG - Intronic
1162373379 19:10291685-10291707 CACGGTACTGGCTCGGAGGGAGG + Exonic
1164713626 19:30376288-30376310 CAGGGCAAAGACACAGATGGAGG - Intronic
1165283756 19:34820067-34820089 CACTGTAAAGGCTCAGAGGAAGG + Intergenic
1165700445 19:37933235-37933257 CAGGGCAAAGTCTCCGAGGGAGG - Intronic
1167348775 19:48962638-48962660 GGGGGTAAAGACCCAGAGGGGGG - Intergenic
1167793374 19:51693918-51693940 CAGGGCAAAGACTCAGAGAGGGG + Intergenic
930245392 2:48978682-48978704 CAAGGTCAAGACTCACAAGGGGG + Intronic
930901074 2:56508319-56508341 CACTGTGTAAACTCAGAGGGAGG + Intergenic
933295626 2:80487612-80487634 CATGGGAAAGACCCAGTGGGAGG - Intronic
935845967 2:107165939-107165961 CACGGTGAGGAATCTGAGGGTGG + Intergenic
937349244 2:121150029-121150051 GCAGGTAAAGACACAGAGGGAGG + Intergenic
940089306 2:149898018-149898040 CACTGTAAATCCTCAGAGAGTGG + Intergenic
940099925 2:150023335-150023357 CAGGGTAATGCCTCAGAAGGTGG - Intergenic
940849351 2:158673364-158673386 CTCAGTAAAGATTCGGAGGGAGG + Intronic
948317672 2:237041429-237041451 CAGGTTAAAGACACACAGGGAGG - Intergenic
1168968517 20:1914742-1914764 CTGGGCAAAGACTCAGAGGTAGG - Intronic
1170096257 20:12648907-12648929 GACGGTACAGACTCAGAGGGGGG - Intergenic
1173336685 20:42117747-42117769 AACTTTAAAGACTCACAGGGTGG - Intronic
1179401933 21:41092148-41092170 CACTTTAAAGAGTCACAGGGAGG + Intergenic
1179634046 21:42696218-42696240 CACGCAAGAGACTCAGAGGAAGG - Intronic
1182035111 22:27192364-27192386 CACGGTGAAGACTTAGTGGGCGG - Intergenic
1185195978 22:49469854-49469876 CATGGTAAAGACCCTGGGGGAGG + Intronic
949097746 3:106205-106227 CATGATAAAGACTCACTGGGTGG - Intergenic
950119940 3:10475058-10475080 CACTGAACAGACTCAGAGGAAGG + Intronic
951829610 3:26911367-26911389 CAAGGTGAGGACTCAGAAGGAGG + Intergenic
955430573 3:58840418-58840440 CAAGGTAGACACACAGAGGGTGG + Intronic
958628589 3:96658040-96658062 CCCGGTACAGACACAGAGAGAGG - Intergenic
959389576 3:105758344-105758366 CACGATAAAGACACAGATGCTGG + Intronic
969503854 4:7571361-7571383 AAGGGCAAAGACTCAGAGGTGGG + Intronic
970306279 4:14735485-14735507 CATGGTAAGGACTCAGAAGTTGG + Intergenic
970329091 4:14960907-14960929 CACGGTAAAATATCAGATGGTGG - Intergenic
971499628 4:27304502-27304524 CATGGGAAAGACCCAGTGGGAGG - Intergenic
972063166 4:34906679-34906701 CATGGGAAAGACACAGTGGGAGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976947728 4:90791215-90791237 CATGGGAAAGACCCAGTGGGAGG - Intronic
978465627 4:109005674-109005696 CACGGTCATGACTCAGACAGGGG + Intronic
980300242 4:130981913-130981935 CAAGGGAAGGACTCAGTGGGAGG - Intergenic
982448162 4:155519118-155519140 CTCGGTAAAGAAACAAAGGGAGG + Intergenic
982719429 4:158844385-158844407 CATGGAAAAGGCTCAAAGGGAGG - Intronic
983909307 4:173219123-173219145 CTCGGGAAAGACTGGGAGGGAGG - Intronic
984959490 4:185081627-185081649 GACAGTGGAGACTCAGAGGGTGG - Intergenic
985394435 4:189526479-189526501 CATGGGAGAGACTCAGTGGGAGG + Intergenic
986006149 5:3670669-3670691 CACGGTCAAGTCTCTGAAGGGGG - Intergenic
986475821 5:8131080-8131102 CATGGTACTGACCCAGAGGGAGG - Intergenic
990664310 5:58054591-58054613 CATGGGAGAGACTCAGTGGGAGG + Intergenic
994974652 5:106786951-106786973 CACAGGAAAGACTGAGAGGAAGG - Intergenic
997693007 5:135839747-135839769 CATGGGAAAGACCCAGTGGGAGG + Intronic
997799147 5:136842487-136842509 CAGGTCAGAGACTCAGAGGGTGG - Intergenic
998795933 5:145818924-145818946 CATGGGAGAGACTCAGTGGGAGG + Intronic
998930994 5:147181415-147181437 CATGGGAGAGACTCAGTGGGAGG + Intergenic
1001812076 5:174636415-174636437 CACGTTCAGGACTCAGAGCGGGG - Intergenic
1003522387 6:6869174-6869196 CAAGTCAAAGACTCACAGGGAGG - Intergenic
1004984081 6:21059921-21059943 AACAGTGAAGACTCAGAAGGGGG - Intronic
1006689304 6:35866993-35867015 GACAATGAAGACTCAGAGGGTGG + Intronic
1010656403 6:78516671-78516693 AACTGTGAAGACTCAGGGGGTGG + Intergenic
1014661904 6:124182236-124182258 CATGGGAGAGACTCAGTGGGAGG - Intronic
1016726844 6:147381132-147381154 CATGGAAAAGACCCAGTGGGAGG - Intronic
1018512935 6:164545397-164545419 AAGCTTAAAGACTCAGAGGGAGG + Intergenic
1019402289 7:862404-862426 CACAGAAAGAACTCAGAGGGTGG - Intronic
1020851931 7:13364384-13364406 CCCAATAAAGACACAGAGGGAGG - Intergenic
1027135860 7:75623488-75623510 CACAGTACAGACACAGACGGAGG + Intronic
1028589273 7:92479099-92479121 CCCTGTACAGACACAGAGGGAGG - Intergenic
1028682568 7:93553524-93553546 AATGGTAAAGACACAGAGTGGGG + Intronic
1028754623 7:94421056-94421078 CATTGTAAATACTCACAGGGGGG - Exonic
1033647035 7:143313087-143313109 CAGGGTAGAGGCTCAGAAGGAGG + Intergenic
1034673965 7:152878315-152878337 CACGATATAGACACAGAGGAAGG - Intergenic
1037757957 8:21723615-21723637 CACTGGAGAGAATCAGAGGGTGG - Intronic
1039897770 8:41728400-41728422 GACACTGAAGACTCAGAGGGTGG + Intronic
1040541619 8:48362158-48362180 CAGGGAAACCACTCAGAGGGGGG + Intergenic
1040573083 8:48626706-48626728 CACAGGAAAGACAAAGAGGGCGG + Intergenic
1045672404 8:104570831-104570853 CAAGCTACAGATTCAGAGGGGGG + Intronic
1048821396 8:138383919-138383941 CTAGGAAAAGATTCAGAGGGAGG - Intronic
1055850410 9:80621510-80621532 GATGGTAAAGACCCAGTGGGAGG + Intergenic
1057740431 9:97706613-97706635 CAGGGATAAGCCTCAGAGGGGGG - Intergenic
1057982878 9:99679840-99679862 CATGGGACAGACCCAGAGGGAGG + Intergenic
1061130330 9:128704558-128704580 CACAGTCAAGACACAGAGGAGGG - Intronic
1188107775 X:26164275-26164297 CAAGGTAAAGATGCTGAGGGAGG + Intergenic
1188440958 X:30215185-30215207 CAAGGTGAGGACTCTGAGGGCGG + Intergenic
1188811641 X:34658747-34658769 CACGGTAATGATTGAGAGGTGGG - Intergenic
1192522343 X:71814128-71814150 CACAGTCAAGGCTCACAGGGAGG - Intergenic
1192561081 X:72128581-72128603 CACAGTAAAGCTTAAGAGGGTGG - Exonic
1193078430 X:77380807-77380829 CAGGGTAAAGAGTCAGAGGTGGG + Intergenic
1195209952 X:102645352-102645374 TATGGTAAGGACCCAGAGGGAGG - Intergenic
1196834478 X:119801831-119801853 CAAGGAAAAGAGTGAGAGGGAGG - Intergenic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1200215434 X:154366147-154366169 CACGGTAGAGCCTCAGCTGGAGG - Exonic
1202048066 Y:20753990-20754012 CCCTGTACAGACACAGAGGGAGG + Intergenic