ID: 1114620000

View in Genome Browser
Species Human (GRCh38)
Location 14:24089993-24090015
Sequence CAGATCATGCAGAGCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 1, 2: 8, 3: 44, 4: 402}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114619991_1114620000 30 Left 1114619991 14:24089940-24089962 CCTGGAAGGTGGGAAGAACAGTG 0: 1
1: 0
2: 3
3: 35
4: 341
Right 1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG 0: 1
1: 1
2: 8
3: 44
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114620000 Original CRISPR CAGATCATGCAGAGCCTGGG AGG Intronic
900238114 1:1601932-1601954 CAGGTCATGGGGAGCTTGGGTGG + Intergenic
900594268 1:3473350-3473372 CTGGCCATGCAGAGCCTGGAAGG + Intronic
901702898 1:11054871-11054893 CACATCATTCAGGGCCTGGAGGG + Exonic
901883110 1:12205383-12205405 CAGATCAGACAGGGCCTGGTAGG + Intronic
902406154 1:16184731-16184753 CTGGTCATGCAGAGCCTTGGTGG - Intergenic
903403721 1:23078973-23078995 CACATCCTGCAGAGGTTGGGTGG - Exonic
903518298 1:23927580-23927602 CAGGTTATGCTGATCCTGGGAGG + Intergenic
904378290 1:30095308-30095330 CCAATCTTGCAGGGCCTGGGTGG - Intergenic
904484368 1:30815034-30815056 CCGATCACGCAGAGCCTCGTGGG - Intergenic
905280624 1:36846755-36846777 CAGACCATGCAGAGCCTTTTGGG + Intronic
905341538 1:37281797-37281819 CAGATTATGCAGGGCCTGGGAGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905984783 1:42270036-42270058 CAGATCATGAAGAGTCTTTGGGG - Intronic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
907772947 1:57484221-57484243 CAGATCATCCTGGGCCTTGGGGG + Intronic
912228085 1:107758754-107758776 CAGATCATGAGGAGTCTAGGAGG - Intronic
912688750 1:111787626-111787648 CAGATCATGCAGCGTCTGACGGG + Intronic
913589420 1:120309152-120309174 CAGTTCAGGCAAAGCCTTGGTGG + Intergenic
913618766 1:120589214-120589236 CAGTTCAGGCAAAGCCTTGGTGG - Intergenic
914571442 1:148921010-148921032 CAGTTCAGGCAAAGCCTTGGTGG + Intronic
914601390 1:149209252-149209274 CAGTTCAGGCAAAGCCTTGGTGG - Intergenic
914843412 1:151266437-151266459 CAGGTGAGCCAGAGCCTGGGTGG + Exonic
915113312 1:153578647-153578669 CAAATCATGCAGAGCCTTGTAGG + Intergenic
915252932 1:154603436-154603458 CACATCCAGGAGAGCCTGGGTGG - Intronic
915318017 1:155040634-155040656 CTGCACAGGCAGAGCCTGGGGGG + Intronic
915489719 1:156244305-156244327 GGGATCACGCAGAGCCTGGCTGG - Exonic
915900337 1:159842119-159842141 CAGATCATGCAGGGTCTGATAGG + Intronic
918327211 1:183421320-183421342 CAGATCATACAGGGCCTTGTAGG + Intergenic
918336176 1:183515907-183515929 CAGGTCCTGCAGAGCCTGCCTGG - Exonic
920737006 1:208541985-208542007 CAGATCATATAGAGACTTGGAGG - Intergenic
922011613 1:221594431-221594453 CAGATTACGCAGGGCCTCGGAGG + Intergenic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
924283871 1:242465503-242465525 AAGATCATGCAGAGCCTCCTGGG - Intronic
924357900 1:243202973-243202995 CAGGTCATGGAGAGCTTGAGAGG + Intronic
924476404 1:244385445-244385467 CAGAGAATTCATAGCCTGGGAGG + Intronic
924563886 1:245179955-245179977 CAGAGGAGGCAGCGCCTGGGGGG + Intronic
1062855638 10:778256-778278 CAGCTCATGCTGGGCCTGTGGGG - Intergenic
1063508272 10:6621707-6621729 CAGAGCATGCAGTGACTGAGAGG + Intergenic
1064785958 10:18894709-18894731 GAGAACATGCAGACCCAGGGAGG + Intergenic
1065277117 10:24096553-24096575 CAGACCCTGCAGAGCCTGGTAGG - Intronic
1065626970 10:27639585-27639607 AAGATCATGCAGAGCCTCGTAGG + Intergenic
1066123263 10:32312181-32312203 CAGATCATGCAGAGTCTTAGGGG + Intronic
1067851359 10:49756745-49756767 CAGCTGAGGCACAGCCTGGGAGG - Intronic
1069565531 10:69461082-69461104 CCGTTCATGCAGATGCTGGGAGG + Intronic
1069777052 10:70933348-70933370 CAGTTCATGCTGAGCCTGGAGGG - Intergenic
1070526491 10:77300019-77300041 CAGCTCATGCTGAGCCTCTGTGG + Intronic
1070700434 10:78597985-78598007 CTGATCCTGCAGTGCCCGGGGGG - Intergenic
1070764669 10:79049381-79049403 CAGATTGGGCAAAGCCTGGGAGG + Intergenic
1071420927 10:85498305-85498327 CAGATCATGTAGAGCTTTGCAGG - Intergenic
1071569038 10:86686443-86686465 CAGCCCCTGCAGACCCTGGGAGG + Intronic
1071757420 10:88559439-88559461 CAGATTATGGTGAGCCTTGGAGG - Intronic
1072248492 10:93563587-93563609 CAGTTCATGCAGAGCCGGATGGG - Intergenic
1072475502 10:95756175-95756197 CACAGCAAGCAGAGGCTGGGGGG + Intronic
1073176955 10:101562505-101562527 CAGATCATGCCCACGCTGGGAGG - Intergenic
1073559808 10:104487104-104487126 CAGACCATGCAGAGCCTGAATGG + Intergenic
1074296736 10:112196075-112196097 AAGGCCAAGCAGAGCCTGGGAGG + Intronic
1075462524 10:122627018-122627040 CAGATCATTCAGGGCCTTGTGGG + Intronic
1075911145 10:126126785-126126807 GAGAGCGTGCAGGGCCTGGGTGG + Intronic
1075995326 10:126872224-126872246 AAGCTCATGCAGGCCCTGGGGGG + Intergenic
1076410001 10:130242182-130242204 CTGATCTTGCCCAGCCTGGGGGG + Intergenic
1077092035 11:782968-782990 GAGTTCCCGCAGAGCCTGGGGGG + Intronic
1077865646 11:6219037-6219059 GAGACCATGCAGAGCTGGGGGGG + Exonic
1077906917 11:6541625-6541647 CAGATCATGCAAAGTCTTGTGGG + Intronic
1078302790 11:10150086-10150108 CAGATATGGCAGAGACTGGGTGG - Intronic
1078633764 11:13030162-13030184 CACAACATGCAGAGCCCAGGAGG + Intergenic
1078729127 11:13959984-13960006 CAGATCAAGCAGAGCCTTGGAGG + Intergenic
1079619970 11:22542025-22542047 CAGATCATGCAATGCCTTGTGGG + Intergenic
1081784026 11:45733728-45733750 AGGGTCATGCAGGGCCTGGGAGG - Intergenic
1082813348 11:57491923-57491945 CAGCTCATGCAGTTCTTGGGGGG + Intronic
1083229636 11:61308142-61308164 CAGAACGTGCAGAGCCTGGTAGG - Intronic
1083404346 11:62446328-62446350 CAGATCCTGCAGAGTCAGGTGGG - Intronic
1084427769 11:69094893-69094915 CACAACCTGCAGGGCCTGGGAGG - Intergenic
1084567623 11:69940354-69940376 CAGACCAGGCACAGCCAGGGAGG - Intergenic
1084942061 11:72618213-72618235 CAGAGCAGGCAGTGCCTGGATGG - Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1085807438 11:79649245-79649267 CAGATCAGACATGGCCTGGGTGG - Intergenic
1086304966 11:85469977-85469999 CAGATCTTGTAGAGCCTTGTAGG - Intronic
1086851084 11:91809794-91809816 CAGAAAATACAGAGGCTGGGAGG - Intergenic
1087266477 11:96067026-96067048 CAGATCTTGTAGGGCCTGTGAGG + Intronic
1088233700 11:107700167-107700189 CTTATCATGCAGACCCTGGCTGG + Intergenic
1088280055 11:108126432-108126454 CAGATCATGCAGGTTCTTGGAGG + Intronic
1088722666 11:112608309-112608331 CAGAACATACAGAACCTGGCTGG + Intergenic
1089059414 11:115614197-115614219 CAGATGATTCAGACGCTGGGAGG + Intergenic
1089270922 11:117300686-117300708 CAGCTCATGAGGAGCCTGGAAGG - Intronic
1090095889 11:123741474-123741496 CAGATCGGGCAGAGCCGGGCAGG - Intronic
1090131186 11:124144016-124144038 CAGAGAATTCAGAGCCTGGTGGG - Intronic
1091020492 11:132095381-132095403 CAGTCCCTGCAGAGCCTTGGCGG - Intronic
1091301992 11:134513847-134513869 CAGAGCCTGCAGAGACTGGCTGG + Intergenic
1091418876 12:317369-317391 AAGATCATGGTGAGCTTGGGTGG - Intronic
1091985417 12:4907318-4907340 CAGATCATGCAGGGCCTCTAAGG - Intergenic
1092391985 12:8088720-8088742 CAGATCACGCAGGGCCTTGTGGG - Intronic
1092451669 12:8607996-8608018 CAGATCTGCCTGAGCCTGGGAGG - Intronic
1093636507 12:21477156-21477178 AAGATCAAGAAGAGTCTGGGAGG - Intronic
1095241217 12:39860977-39860999 CAAATCATGTAGAGCCTCAGAGG - Intronic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1095926404 12:47583850-47583872 CAGACCATGTAGGGCCTTGGGGG + Intergenic
1095930529 12:47620693-47620715 CAGAGCGGGCAGAGCCTGGGGGG + Intergenic
1096600389 12:52724646-52724668 CAGATGATGCTGGGCCAGGGAGG + Intergenic
1097896526 12:64829104-64829126 CAGATCGTGGAGAACCTGGTGGG + Intronic
1098107202 12:67081645-67081667 CAGATTATGCAAAGCCTGGATGG + Intergenic
1098216946 12:68230725-68230747 AAGATCATGCAGAGCCTTTTAGG + Intergenic
1099210901 12:79787267-79787289 CAGATCATGCAGTGCCTTATAGG - Intronic
1100358906 12:93858369-93858391 CAGAGTATGCAAAGCCTGTGTGG + Intronic
1101003801 12:100382167-100382189 CTGATCATCCATAGCCTGGTAGG + Intronic
1101821182 12:108185370-108185392 GACACCATGCAGAGACTGGGAGG - Intronic
1102060345 12:109926616-109926638 CTGAGCCTGCAGAGACTGGGGGG - Intronic
1102163930 12:110791138-110791160 CAGATGATGCCAAGCATGGGTGG - Intergenic
1102420497 12:112799572-112799594 CAGAGAATGCCAAGCCTGGGAGG - Intronic
1102510903 12:113414753-113414775 CACATCACGCAGAGCCTTGGAGG - Intronic
1102819346 12:115894735-115894757 CAGATCCTGTAGAACCTTGGAGG + Intergenic
1102950361 12:117027007-117027029 TAGATGATGGAGAGCCTGGCTGG + Intronic
1103400329 12:120639616-120639638 CAGAACAGGGAGAGCCTGGGAGG + Intergenic
1103415401 12:120739293-120739315 CAGGCCATCCAGATCCTGGGCGG + Exonic
1103940541 12:124499193-124499215 CAGATCCTGGAGACCCTGGAGGG - Intronic
1104017747 12:124971811-124971833 GAGAGCATGCAGGGCCCGGGTGG - Intronic
1104236551 12:126943925-126943947 CAGTTGTGGCAGAGCCTGGGAGG + Intergenic
1104416796 12:128602428-128602450 CAGATCAGGCAGAGCTCGAGAGG - Intronic
1104657160 12:130581900-130581922 CAGGTCATGCAGAGCCTTTCGGG - Intronic
1104878506 12:132053335-132053357 CTGATCAGCCAGAGCCTGAGGGG - Exonic
1105752178 13:23431513-23431535 CTGATCTTGGACAGCCTGGGTGG - Intronic
1106310082 13:28546444-28546466 TAGATCATGCAGAACCTTGTAGG + Intergenic
1107001918 13:35557482-35557504 CAGAGCATGCAGACTCTGGTGGG + Intronic
1107821029 13:44285843-44285865 CAGTTCATGCAGGACCTGAGGGG - Intergenic
1107993975 13:45842692-45842714 GAGAGCATGCAGACTCTGGGAGG + Intronic
1108161549 13:47645463-47645485 CAGATCATGCAGGGCCCTGTAGG - Intergenic
1109416399 13:62046564-62046586 CAGGTCCTGCAGAGCAGGGGAGG + Intergenic
1110064765 13:71089386-71089408 CAGATCATGTAGAACCTGGTGGG + Intergenic
1114187189 14:20411748-20411770 CAGTTTATGGAGATCCTGGGAGG - Intronic
1114484747 14:23056008-23056030 GAATACATGCAGAGCCTGGGTGG - Intronic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1116085817 14:40236625-40236647 CATATCATGTAGTGACTGGGGGG - Intergenic
1117611160 14:57484728-57484750 CAGGTCATGCAGGGCCTGACAGG + Intronic
1117803624 14:59468288-59468310 CAAATCATGCAGTGCCTTGTAGG - Intronic
1118203697 14:63701654-63701676 CAGATCAAGTAGAGCCTGGGAGG + Intronic
1118221238 14:63856195-63856217 CAGATCATGCAGGGCCTTTCTGG + Intronic
1119757723 14:77130656-77130678 CAGATGTTGCAGGGCCTGAGAGG + Intronic
1120013670 14:79445814-79445836 CAGATCATGGAGGGCCTTTGGGG + Intronic
1120362279 14:83519922-83519944 AAGATCAGGCAGAGGCTGTGTGG + Intergenic
1120505591 14:85351480-85351502 CAGACCATGCAAAGCCCTGGGGG - Intergenic
1122146141 14:99689943-99689965 CAGGTCATGTAGAGCCTTGTGGG - Intronic
1122866850 14:104609888-104609910 CAGATCCTGCAGAGCCATCGGGG + Intergenic
1123188761 14:106546769-106546791 CAGTTCATGCAAAACCTGGCAGG - Intergenic
1202859382 14_GL000225v1_random:72150-72172 CAGCTCCTGTAGCGCCTGGGAGG + Intergenic
1124241020 15:28027660-28027682 CAAATCATGCAGCGCCGGAGAGG - Intronic
1124711446 15:32016075-32016097 CACATTATGCAGAGGCAGGGAGG - Intergenic
1124913967 15:33950576-33950598 AAGATCTTGAAGAGCCTGTGTGG + Intronic
1125007902 15:34838648-34838670 CAGAACAGGCATAGCCTGAGTGG - Intergenic
1125102745 15:35933822-35933844 CAGATCATCCAGGGCCTTGTTGG + Intergenic
1125306356 15:38320392-38320414 CAGCTCATGCAGGGCCTAGTAGG + Intronic
1125841612 15:42806502-42806524 CAGATAATGCAGGGCCTTGTAGG - Intronic
1125896733 15:43308781-43308803 CAGATCATGCAGAGCTTTGGGGG - Intergenic
1127387089 15:58475382-58475404 CAGATGGTGAAGGGCCTGGGTGG - Intronic
1127440549 15:59002714-59002736 CAGATCAGGTAGAGCCTGTAGGG - Intronic
1129196401 15:73969786-73969808 CAGCTCATGTAGGGCCTGGTAGG - Intergenic
1129596310 15:76967207-76967229 CAGCTCAGGAAAAGCCTGGGAGG - Intergenic
1130417226 15:83705243-83705265 AAGATGATGTAGGGCCTGGGTGG + Intronic
1131611887 15:93973624-93973646 AAAATGATCCAGAGCCTGGGCGG + Intergenic
1132009439 15:98262807-98262829 CACATTTGGCAGAGCCTGGGAGG + Intergenic
1132804562 16:1769545-1769567 CTGCCCAGGCAGAGCCTGGGGGG - Exonic
1132942002 16:2513138-2513160 CAGAACGTGCAGAGCCCGGGGGG + Intronic
1133722334 16:8506716-8506738 CAGATGATGAAGGGCCTGGCAGG + Intergenic
1134666411 16:16022150-16022172 CAGGTCAGGCAGGGCGTGGGTGG + Intronic
1134825741 16:17282684-17282706 CAGGTCTTGCAGCCCCTGGGAGG - Intronic
1136056730 16:27695311-27695333 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1136359942 16:29772577-29772599 CAGAGTGTGCAGAGCCTGAGAGG - Intergenic
1136748667 16:32614192-32614214 CAGCTCAGGCAAACCCTGGGAGG + Intergenic
1136869387 16:33791523-33791545 CAGTTCATGCAAAACCTGGCAGG + Intergenic
1138519867 16:57564856-57564878 CAGCACATGCAAAGGCTGGGAGG + Intronic
1139477596 16:67210413-67210435 CAGAGCCTGCAGGGCCTCGGGGG + Exonic
1139510992 16:67428530-67428552 CAGATAAAGCAGGGCCTGGCAGG - Intergenic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1139608211 16:68035310-68035332 CAGATCATGTAGAGCCTTGTAGG - Intronic
1139656316 16:68389183-68389205 CAGAGCAGGGAGGGCCTGGGGGG + Intronic
1140244828 16:73238696-73238718 CAGGTCATGAACAGCCTGGAAGG - Intergenic
1141250998 16:82359034-82359056 CAGATCACACAGAGCCTGCAGGG + Intergenic
1141270865 16:82540165-82540187 CAGTCCATGCAGAGCCCGTGAGG + Intergenic
1141992809 16:87620184-87620206 CAGCGCAGGCTGAGCCTGGGTGG + Intronic
1203050800 16_KI270728v1_random:873406-873428 CAGCTCAGGCAAACCCTGGGAGG + Intergenic
1203102786 16_KI270728v1_random:1324545-1324567 CAGTTCATGCAAAACCTGGCAGG - Intergenic
1143681569 17:8479927-8479949 GTGAGCATTCAGAGCCTGGGAGG - Intronic
1145011252 17:19369537-19369559 CAGATCACCCAGCGCCTGAGTGG + Intronic
1145222115 17:21097891-21097913 CAGATCAGGAAGAGCCTTGTGGG + Intergenic
1146241602 17:31233918-31233940 CAGATCAGGTAGAGCCTTGTAGG - Intronic
1146791803 17:35755074-35755096 TAGATCATGCAGGGCCTTGTAGG + Intronic
1147863693 17:43539171-43539193 CAAGTCATGCAGAGCCTTGGAGG - Intronic
1148380830 17:47195638-47195660 CAGTACATGCAAAGCCTGTGAGG - Intergenic
1149599527 17:57884614-57884636 CAGCTTGTGCAGAGTCTGGGAGG - Intronic
1150717133 17:67581561-67581583 AGGGTCAAGCAGAGCCTGGGGGG - Intronic
1151354182 17:73548773-73548795 CCCACCATGCAGAGCCTGGTTGG - Intronic
1152252861 17:79220815-79220837 CAGCTCCTGCAGAGGCGGGGCGG + Intronic
1152473061 17:80500876-80500898 CAGAACATGCATCTCCTGGGAGG - Intergenic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1153464539 18:5374625-5374647 CAGATGATGCAGAGCTTTGAAGG - Intergenic
1154955977 18:21255127-21255149 CAGATTATGAAGAGCCTTGAAGG - Intronic
1155351135 18:24907455-24907477 GAGAACATGCAGAGCCTGCCAGG - Intergenic
1158957303 18:62552167-62552189 CAGCTCATCCACAGCTTGGGGGG - Intronic
1159807531 18:72974290-72974312 CAGATCATGTAGAGCCTGAGAGG - Intergenic
1160452730 18:78977090-78977112 AAGATCCGGCAGAGCCTTGGAGG - Intergenic
1160676335 19:393339-393361 CAGGTCATTCAGGGCCTGGTGGG + Intergenic
1160967651 19:1753669-1753691 CTGAGCCTGGAGAGCCTGGGGGG + Exonic
1161301596 19:3545370-3545392 CAGGTCGTGCAGGGCCTGGTGGG - Intronic
1161621412 19:5299225-5299247 CAGGTCATGCAGGGCCTTGTGGG - Intronic
1161634238 19:5377234-5377256 CAGGTCATGCAGGGCCTTGTGGG + Intergenic
1161650382 19:5480608-5480630 CAGGTCGTGCAGGGCCTGGTAGG + Intergenic
1161703230 19:5805854-5805876 CGGATCCTGCAGAGCCCGGGCGG + Intergenic
1162158522 19:8695993-8696015 CACATCATGGGGTGCCTGGGAGG + Intergenic
1162280124 19:9689697-9689719 CGGATCCTGCAGAGCATGGCAGG - Intergenic
1162431046 19:10628751-10628773 CAGAGCAAGCATAGCCTGAGTGG + Intronic
1162439138 19:10682008-10682030 CAGGGCATTCATAGCCTGGGGGG - Exonic
1162449835 19:10748079-10748101 CAGGTCGTGCAGGGCTTGGGGGG + Intronic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1162544698 19:11321693-11321715 CAGATCATGCAGGGCCCCGGGGG + Intronic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1162923316 19:13916830-13916852 CAGATTTTGCAGACACTGGGTGG + Intronic
1163017802 19:14467481-14467503 CAGATCTTGCAGGGCCTCGGAGG + Intronic
1164494461 19:28746606-28746628 CAGATCCTGCAGAGCCCTGGAGG - Intergenic
1165710158 19:38005306-38005328 CAGAGCAAGCAGGGTCTGGGGGG - Intronic
1167109348 19:47449815-47449837 CAGATCACCTAGGGCCTGGGTGG + Intronic
1167294008 19:48638992-48639014 CAGATCTTCCAGAGCCTCAGCGG - Exonic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1167564535 19:50248176-50248198 CAGATCATGCAGGGTCTTAGGGG + Intronic
1168353613 19:55689531-55689553 CAAGTCAGACAGAGCCTGGGTGG + Intronic
925755811 2:7131446-7131468 GAGATCCTGCAGAGCCTGCCAGG - Intergenic
926762643 2:16292353-16292375 CAGATGAGGCAAAGACTGGGGGG - Intergenic
927601805 2:24449298-24449320 CAGATCATGTAGATCCTTGTAGG - Intergenic
928405387 2:31010710-31010732 CTGATCAGGCAGGGCCTTGGGGG - Intronic
928493694 2:31810182-31810204 CAGATAATGCTGATGCTGGGGGG - Intergenic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930755306 2:54967172-54967194 CAGATCCTGCACAGACTTGGAGG - Intronic
931979735 2:67681787-67681809 TAGAAGATGCAGAGCCTTGGAGG - Intergenic
932405757 2:71511886-71511908 CAGGTCAGGCAGAGTCGGGGAGG - Exonic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
933613810 2:84463302-84463324 CAGATCATGCCAGACCTGGGAGG + Intergenic
933813463 2:86047865-86047887 CAGGAGAGGCAGAGCCTGGGTGG + Intronic
933938807 2:87228464-87228486 CAGATCATGAACAGCCTCAGTGG + Intergenic
934518837 2:95006787-95006809 CAGACTATGCAGTGCCTCGGTGG + Intergenic
935410336 2:102755534-102755556 CATACCATGCTGTGCCTGGGTGG - Intronic
935593378 2:104861781-104861803 CAGAACTTGGAGAGCCTGAGAGG - Intergenic
936071867 2:109376412-109376434 CTGCTCACACAGAGCCTGGGTGG + Intronic
936351079 2:111713088-111713110 CAGAGCATGCAGAGCCCTGCAGG + Intergenic
937438857 2:121900396-121900418 CAGAACATGCAGACCCAGTGAGG - Intergenic
940391224 2:153134779-153134801 AATATCAAGCAAAGCCTGGGAGG - Intergenic
941721972 2:168821869-168821891 CAGATCATGCAGAGCTTTGCAGG + Intronic
941801916 2:169669325-169669347 CAGATCATACAGAGCCTTGGAGG + Intronic
942111349 2:172685391-172685413 CAGAACATGCAGAGCCTTGAAGG - Intergenic
942901503 2:181125488-181125510 CAGGTGATGCAGTGCCTGGTAGG - Intergenic
943018010 2:182537839-182537861 CATGTCATACAGAGCCTTGGAGG + Intergenic
943626824 2:190210620-190210642 CAGAGCATACAGAGCCTTGAAGG - Intronic
943713761 2:191127069-191127091 CAAATCATCCAGAGACTGGATGG - Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
945132326 2:206586174-206586196 CAGATCATGTTGAGCTTGGAAGG + Intronic
946127965 2:217581023-217581045 CATGTCATGCAGAGCATGGAAGG + Intronic
946554603 2:220841755-220841777 CAGATTATTCAGACCCAGGGAGG - Intergenic
946926375 2:224631211-224631233 CAGATCATGTAGAGCCTGATGGG + Intergenic
947716125 2:232339687-232339709 CTGAGCATGCAGGGCCGGGGTGG + Intronic
948403926 2:237703559-237703581 CAGGACAAGCAGAGCCGGGGTGG - Intronic
948939080 2:241187339-241187361 CAGCACCAGCAGAGCCTGGGCGG - Intergenic
1169798984 20:9495952-9495974 CAAATCATGTAAAGCCTGGTAGG + Intergenic
1170301539 20:14889730-14889752 CAGATTATGTAGGGCCTTGGAGG + Intronic
1171152030 20:22835697-22835719 CAGATCCTGCAGGGCCTTGCAGG + Intergenic
1172441986 20:34972208-34972230 CAGATCATTCAGAGCCTTGAAGG - Intergenic
1172584136 20:36070758-36070780 CAGACCATCCTGTGCCTGGGTGG + Intergenic
1172972378 20:38883014-38883036 TAGATCATGCAATGCCTTGGAGG + Intronic
1173585710 20:44181667-44181689 CAGAGCATGCAAAAGCTGGGAGG - Intronic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1173916722 20:46713546-46713568 CAGATCCTGCAGAGTCTTGAAGG + Intronic
1174320618 20:49739059-49739081 CAGAACACTCAGAGCCTTGGGGG - Intergenic
1174421978 20:50405237-50405259 CAGATCTTGCAGAGCCTCCTAGG - Intergenic
1175416394 20:58804137-58804159 CACAACATCCAGAGCCTGGATGG + Intergenic
1175467943 20:59205267-59205289 CAAATCCTGCAGGGCCTGGGTGG - Intronic
1175760039 20:61556217-61556239 CAGATCATCCTGGCCCTGGGTGG - Intronic
1175806803 20:61834104-61834126 CAGTCCATGCAGAGCAAGGGTGG + Intronic
1175822350 20:61917203-61917225 CACCTCAGGTAGAGCCTGGGAGG - Intronic
1175975280 20:62707791-62707813 CAAAGCCTGCAGGGCCTGGGAGG + Intergenic
1176167066 20:63679922-63679944 CAGATCATCCAGCACCTGGCAGG + Exonic
1176268475 20:64223041-64223063 CAGAGCAGGCTCAGCCTGGGGGG + Intronic
1178415412 21:32400898-32400920 TGGCTCATGCAGAGCCTGGTTGG + Intergenic
1179889598 21:44328834-44328856 CACATCATGCACACCTTGGGTGG - Intergenic
1180010839 21:45050103-45050125 CAGGACAAGCAGGGCCTGGGTGG - Intergenic
1180215225 21:46319200-46319222 CAGCTCATGGAGATCCTTGGAGG + Intronic
1181830265 22:25555008-25555030 CAGACCCTGCAGGGCCTTGGAGG - Intergenic
1182745745 22:32604293-32604315 TGGATCAGGCAGAGCCTTGGAGG - Intronic
1183704786 22:39469804-39469826 CAGAGGATGGCGAGCCTGGGCGG + Intronic
1183992335 22:41606054-41606076 CAGATCAGGTAGGTCCTGGGAGG + Intronic
1184072867 22:42156947-42156969 CAGCTAGTGCAGAGCCAGGGAGG + Intergenic
1184401468 22:44277000-44277022 CAGCTTAGGCAGAGCCTCGGAGG - Intronic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
950166944 3:10808299-10808321 CTGAGCATGCACAGCCTGTGTGG + Intergenic
950708362 3:14797802-14797824 CTGGTCATGCAGAGCCAGGCAGG - Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951277798 3:20710949-20710971 CAGATCATGCAAGGCCTTGTAGG + Intergenic
951641115 3:24836602-24836624 CAGATCATAAAGAGCTTGGTAGG - Intergenic
952495621 3:33913564-33913586 CAGATCCTCCAGGGCCTGGTGGG - Intergenic
952500775 3:33959811-33959833 CAGATCATGTAGAGCCCTGCAGG + Intergenic
952746546 3:36787278-36787300 CAAATCATGCAGAGGCTCGTAGG - Intergenic
953368765 3:42369755-42369777 CAGATCATGCAGGGGTTGTGGGG - Intergenic
953670314 3:44956887-44956909 CAGATTGTGCAGGGCCTGGTAGG - Intronic
954092969 3:48300238-48300260 AAGATCATGCAGAGCCTGGGAGG - Intronic
954111098 3:48433631-48433653 CAGATCATGGAGGGGCCGGGTGG - Intronic
954260171 3:49433034-49433056 CAGATCCTGCACAGCCTATGGGG + Intergenic
955509156 3:59662134-59662156 CAGATCATGCAGACCCTCACTGG + Intergenic
956150151 3:66232732-66232754 CAGAACCTCCAGAGCCTGGAAGG + Intronic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
960548342 3:118944311-118944333 CAGATTAAGCAGAGCCTTGAAGG - Intronic
960603086 3:119477737-119477759 AAGATCTTACAGAGCATGGGAGG + Intronic
961317357 3:126049679-126049701 CAGATCATGTGGAGCCTTGTGGG - Intronic
962731958 3:138291897-138291919 CAGACCATGAAGAGCCTTGTAGG + Intronic
964373950 3:156031269-156031291 CAGATCATGCAGGGCCCTGTTGG + Intergenic
964466227 3:156996442-156996464 CACATCATGCAGGGCCTTGCAGG + Intronic
966115405 3:176454725-176454747 CAGATCATGTAGAGCCTCAAAGG - Intergenic
967702578 3:192610704-192610726 CAGATCTTGCAGGGCCTTGCAGG - Intronic
967907942 3:194517218-194517240 AAGGTTCTGCAGAGCCTGGGGGG - Intergenic
968979065 4:3836992-3837014 CACAGGAGGCAGAGCCTGGGGGG - Intergenic
969137895 4:5045187-5045209 CCGCTCAGGCAGAGCCTGGCAGG - Intergenic
969312902 4:6364381-6364403 CAGCTCCTGCAGGGCCTTGGAGG + Intronic
973104819 4:46322381-46322403 GAGATCGTGCAGGGCCTTGGAGG - Intronic
973301353 4:48588555-48588577 GAGATCATGCTGTGCCTGAGAGG - Intronic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
975618097 4:76267490-76267512 CAGGCCATGCAGAGCCCTGGAGG + Intronic
979243910 4:118476509-118476531 CAGGTCATGGAGAGCTTGAGAGG - Intergenic
982977107 4:162077523-162077545 CAGATCCAGCATAGCCTGTGGGG + Intronic
983047958 4:163009726-163009748 CAGAGTTTGCAGAGCCTTGGAGG - Intergenic
986136753 5:4987106-4987128 CAGAGCATGGGGAGTCTGGGAGG + Intergenic
986204291 5:5609513-5609535 GAGATCAAGCAGAGCCTCTGAGG - Intergenic
986253326 5:6081275-6081297 CAGAGAATGGAGAGGCTGGGAGG - Intergenic
990007894 5:50964236-50964258 CAGATAATCCAGAGCCAGGCGGG - Intergenic
990344586 5:54858918-54858940 CGGATCCTGCAGAGCATGGCAGG + Intergenic
990887189 5:60607940-60607962 CAGATCATGCAGAACTTTGTAGG + Intronic
991379496 5:66004953-66004975 CAGCTAATGAAGAGCCTTGGAGG + Intronic
991933601 5:71780820-71780842 CAGAGCATGGAGGGCCTGGCAGG - Intergenic
992040497 5:72825931-72825953 CAGATCATGTAGAGCCTCACAGG - Intronic
993142035 5:84046259-84046281 CAGAATCTGCAGAGCCTGGCTGG + Intronic
994335227 5:98556984-98557006 CACATAGTGCAGAGTCTGGGAGG - Intergenic
995132232 5:108642735-108642757 CAGATCATGCAGAGCCTTCCTGG - Intergenic
995305237 5:110639156-110639178 CAGCACATGCAGAGCCTTGTAGG + Intronic
995313163 5:110736783-110736805 CAGATCTTGCAAAGCCTTGTCGG - Intronic
995641441 5:114261788-114261810 CACATCATCCAGAGACTGGCAGG + Intergenic
996550671 5:124726758-124726780 CAGGTCATGCAGGGCCTTGTAGG - Intronic
998130671 5:139649700-139649722 CGCAGCGTGCAGAGCCTGGGAGG + Intronic
998754534 5:145361706-145361728 CAGATCATGAGGAGCCTTGTGGG - Intergenic
998962950 5:147508547-147508569 CAGAAAATGCAGGGCCTGGCAGG - Intronic
999101368 5:149028504-149028526 CAGGCCTGGCAGAGCCTGGGAGG - Exonic
999374993 5:151080805-151080827 CAGATCGTCCAGAGCCTCGGTGG - Intronic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
1000442811 5:161283363-161283385 CAGCACATGCAGAGCTTGGTGGG - Intergenic
1000999136 5:167988703-167988725 CAGATCATGCAGAGAGTTGAAGG + Intronic
1001017359 5:168153624-168153646 CAGATAATGCAGGGCCTTTGAGG + Intronic
1001517127 5:172363771-172363793 CAGATCAGGCAGGGCCTTTGGGG + Intronic
1001990539 5:176112568-176112590 CAGCTCAGGCAAACCCTGGGAGG + Intronic
1002226334 5:177725572-177725594 CAGCTCAGGCAAACCCTGGGAGG - Intronic
1002267514 5:178045641-178045663 CAGCTCAGGCAAACCCTGGGAGG + Intronic
1002441840 5:179268397-179268419 CAGAGCCTGCAGGGCCTGGCAGG - Intronic
1002560595 5:180079488-180079510 CATTTAGTGCAGAGCCTGGGAGG - Intergenic
1003473666 6:6461574-6461596 GCAACCATGCAGAGCCTGGGAGG + Intergenic
1007074280 6:39056908-39056930 CAGTCCATGCACAGGCTGGGAGG - Intronic
1007116092 6:39344442-39344464 CATATCATACACAGCCTGGTAGG - Intronic
1007126892 6:39433050-39433072 CAGAAAAAGCAGAGCCTGGGAGG - Intronic
1008051155 6:46901688-46901710 AAGATGATGCAGTGCCTGCGTGG - Intronic
1009994081 6:70879911-70879933 CCAACCATGCAGGGCCTGGGAGG + Intronic
1010930312 6:81793508-81793530 CACATCATGCATTGCTTGGGTGG + Intergenic
1012411479 6:98962980-98963002 CAGATCTTGTAGATCGTGGGAGG - Intergenic
1013852101 6:114528451-114528473 CAGGTCATGCAGAGCTTTGTGGG - Intergenic
1014275181 6:119380074-119380096 CAGATCATAGAGAACCTAGGAGG + Intergenic
1014555441 6:122839549-122839571 CAGACCATGAAGAGCCTATGTGG - Intergenic
1014805788 6:125827849-125827871 CAGATCATGCAGGGCCTTCTTGG + Intronic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015809094 6:137143292-137143314 CAGATCATACAGCGCCTTGGAGG + Intergenic
1017916436 6:158835404-158835426 CAGATCCTTGAGAACCTGGGTGG + Intergenic
1018684038 6:166289518-166289540 TAGATCATGCAGAGTCTTGTAGG - Intergenic
1019120826 6:169802137-169802159 CAGGTCCTCCGGAGCCTGGGTGG - Intergenic
1019316618 7:389982-390004 AAGAACTTGCAAAGCCTGGGGGG - Intergenic
1019375364 7:688502-688524 CAGATCACGCAGGGCCTTGCTGG - Intronic
1020715514 7:11670233-11670255 CAGATTCTGGAGAGCCTGGAAGG + Intronic
1021874190 7:25033098-25033120 CAGGTCATGCAGGGCCTGATGGG + Intergenic
1022491826 7:30826589-30826611 CAGATCATGGAGAGCCTTGCAGG + Intronic
1022606271 7:31817440-31817462 CAGATCATGCAGGGCTTTGGAGG + Intronic
1022656950 7:32328446-32328468 CAGATCATGCAGGGACTTGGAGG - Intergenic
1022808466 7:33846415-33846437 AAGGTCATGCAGAGCAAGGGCGG + Intergenic
1023066687 7:36384934-36384956 CAGATCATGCATGGCCTTGTAGG + Intronic
1023740741 7:43278577-43278599 CAGATCACATAGAGCCTCGGAGG - Intronic
1025029647 7:55546827-55546849 CAGGCCATGCAGAGCCTGGGAGG + Intronic
1025248851 7:57338206-57338228 CAGATCTTGCAGAGCCTCATGGG + Intergenic
1025256791 7:57389247-57389269 GAGGTCGTGCAGACCCTGGGTGG - Intergenic
1027645335 7:80790488-80790510 CAGATCATGCAGAGGCCTGTAGG - Intronic
1027681605 7:81229646-81229668 CAGATCATGTAGAGCTTTGTAGG + Intergenic
1028510578 7:91621008-91621030 CAGAGCATGGAGGGCCTGGGAGG - Intergenic
1029360975 7:100088604-100088626 CAGATCAGGCAGGGCCTTGCAGG + Intergenic
1029372026 7:100156381-100156403 CAGAGCATGCACAGGCTGGTAGG - Exonic
1029579510 7:101426200-101426222 CTGAGCGAGCAGAGCCTGGGTGG + Intronic
1029733699 7:102454044-102454066 CAGATGCTGCAGAGCCCTGGTGG + Exonic
1030729664 7:112971644-112971666 TAGACCATGCAGAGCCTTGTAGG + Intergenic
1031406906 7:121396492-121396514 CAGATTGTGCAGCGCCTGGCCGG - Intergenic
1031720066 7:125163316-125163338 GAGATTATGCAGAGTTTGGGAGG - Intergenic
1032771579 7:135064344-135064366 CAGGTCATGTAAAGCCTGGTAGG + Intronic
1034517036 7:151589172-151589194 CAGGTAAGGCAGTGCCTGGGTGG - Intronic
1035160216 7:156944614-156944636 CAGATCCTGCAGCTCCTGGACGG + Intergenic
1035488559 7:159252133-159252155 CAGAGCAGGCAGAGCCAGGTAGG - Intergenic
1035488930 7:159255090-159255112 CAGATGATGCAGCTCCTGTGGGG + Intergenic
1036640091 8:10577843-10577865 CAGAGCCTGCAGTGTCTGGGAGG + Intergenic
1037575099 8:20195145-20195167 CAGATCATGTACAGCTTTGGAGG - Intergenic
1037982350 8:23263253-23263275 GAGATGATGCCGTGCCTGGGAGG + Intergenic
1039298755 8:36186509-36186531 GAAGTCATGGAGAGCCTGGGTGG + Intergenic
1042096903 8:65226144-65226166 CAGATCACGCAGGGCCTTGTAGG + Intergenic
1042939810 8:74096282-74096304 CAGATCATGCAGAGCCTCATTGG - Intergenic
1043877610 8:85503785-85503807 CAGATCATGTAAGGCCTTGGGGG - Intergenic
1043988679 8:86724939-86724961 CAGACCAGGCAGGGCCTGAGAGG + Intronic
1044227427 8:89735796-89735818 CTGCTCCTGCAGAACCTGGGAGG + Intergenic
1044934473 8:97279448-97279470 CAGATCATACAGGGCCTTGCAGG - Intergenic
1045502686 8:102755596-102755618 CAGTTAATGCAGAACCTGTGGGG - Intergenic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1046937179 8:119895682-119895704 CAGATCAAGCTGAGCCTCTGAGG + Intronic
1047285027 8:123480345-123480367 CAGATCATGCAGGGTCTTTGTGG + Intergenic
1047779902 8:128102574-128102596 CAGACTATGAAGAGGCTGGGTGG + Intergenic
1047968216 8:130063264-130063286 AAGATCATTTGGAGCCTGGGAGG - Intronic
1048012312 8:130467769-130467791 CAGATTATGTAGAGCCTTGCAGG + Intergenic
1049011044 8:139887596-139887618 CAGAACACGCAGAGTGTGGGAGG - Intronic
1049418638 8:142506987-142507009 CAGATGTTGCAGGCCCTGGGTGG + Intronic
1049469435 8:142768878-142768900 CTGCTCATTCAGGGCCTGGGAGG + Intronic
1051864452 9:21663724-21663746 TAGTTCCTGCAAAGCCTGGGTGG - Intergenic
1052707287 9:32008949-32008971 CAGGTCAGGCAGACCCTGGGTGG + Intergenic
1052786179 9:32830695-32830717 CAGACCCTGCATGGCCTGGGTGG - Intergenic
1053099921 9:35363177-35363199 CAGATCATGGAGAGCCGTGACGG + Intronic
1055392530 9:75838390-75838412 CAGATCATGGAGAACCTGGTGGG - Intergenic
1057592231 9:96382764-96382786 CAGCTCGTGCAGAGCCCTGGAGG + Intronic
1058007659 9:99935958-99935980 CAGATCATGGAGAGCCTTGCAGG + Intronic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1059385689 9:113962507-113962529 CAGCTCATGCAGAGCCTTGCAGG - Intronic
1060185304 9:121560466-121560488 CAGATTTTGCAGGGCCTGGCAGG + Intergenic
1060876640 9:127088830-127088852 CAGTTCATCCTGAGGCTGGGAGG - Exonic
1062178356 9:135176722-135176744 CAGATGATGAAGGGCCTGTGAGG + Intergenic
1062447275 9:136600225-136600247 CAGAGCAGACAGAGGCTGGGAGG - Intergenic
1062502718 9:136858223-136858245 CAGATCATCCAGAGCCACGTAGG - Exonic
1062548077 9:137072671-137072693 CATACCATCCAGAGCCTTGGGGG + Intergenic
1062609570 9:137368009-137368031 CAGATTACTCAGGGCCTGGGAGG + Intronic
1062697038 9:137880794-137880816 CAGAGCAGGCCGAGGCTGGGTGG + Intronic
1186840613 X:13481294-13481316 CAGATCCTGGAGAGCTTGTGGGG + Intergenic
1187248494 X:17575270-17575292 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1189380385 X:40498648-40498670 CAGATCATCAAGAGCCCCGGAGG - Intergenic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1190232207 X:48590797-48590819 CAGATCAAGCAAAGCGAGGGCGG + Intronic
1190740278 X:53284040-53284062 CCCAGCATGCAGAGCCTTGGAGG + Intronic
1190981255 X:55458311-55458333 CACATTATGTAGGGCCTGGGAGG + Intergenic
1190987443 X:55514869-55514891 CACATTATGTAGGGCCTGGGAGG - Intergenic
1192225713 X:69226617-69226639 CAGGGCATGCAGAACCTGAGAGG - Intergenic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1192538332 X:71947459-71947481 CAGATTGTGCTGAGGCTGGGGGG + Intergenic
1195091220 X:101460969-101460991 CAGAGCATTCAGAGCCCTGGAGG - Intronic
1197415909 X:126172532-126172554 CATATCATGCTGGGCCTGGTAGG - Intergenic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1198131893 X:133704090-133704112 TAGATCATGCAGAGCCCAGTAGG + Intronic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1198789394 X:140327128-140327150 CAGATCATGAAGGGCCTCGTGGG + Intergenic
1199319321 X:146419809-146419831 CAGCTCATTCAGGGCCTGGTAGG + Intergenic
1200870212 Y:8089675-8089697 CATATCATATAAAGCCTGGGTGG - Intergenic