ID: 1114620127

View in Genome Browser
Species Human (GRCh38)
Location 14:24090827-24090849
Sequence AGCTTTAGGCAGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114620127_1114620132 -2 Left 1114620127 14:24090827-24090849 CCTTGCTCCATCTGCCTAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 203
Right 1114620132 14:24090848-24090870 CTAGAGAAGAAAGTAATGGTGGG 0: 1
1: 1
2: 2
3: 20
4: 263
1114620127_1114620133 -1 Left 1114620127 14:24090827-24090849 CCTTGCTCCATCTGCCTAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 203
Right 1114620133 14:24090849-24090871 TAGAGAAGAAAGTAATGGTGGGG 0: 1
1: 0
2: 1
3: 39
4: 492
1114620127_1114620134 20 Left 1114620127 14:24090827-24090849 CCTTGCTCCATCTGCCTAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 203
Right 1114620134 14:24090870-24090892 GGAAGAAGAATTCAGAAACGTGG 0: 1
1: 0
2: 0
3: 20
4: 332
1114620127_1114620130 -6 Left 1114620127 14:24090827-24090849 CCTTGCTCCATCTGCCTAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 203
Right 1114620130 14:24090844-24090866 AAAGCTAGAGAAGAAAGTAATGG 0: 1
1: 0
2: 5
3: 99
4: 1065
1114620127_1114620131 -3 Left 1114620127 14:24090827-24090849 CCTTGCTCCATCTGCCTAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 203
Right 1114620131 14:24090847-24090869 GCTAGAGAAGAAAGTAATGGTGG 0: 1
1: 0
2: 0
3: 39
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114620127 Original CRISPR AGCTTTAGGCAGATGGAGCA AGG (reversed) Intronic
902706929 1:18212084-18212106 AGCTGCAGGGAGCTGGAGCATGG + Intronic
902788942 1:18752049-18752071 AGCACTGGGGAGATGGAGCAGGG + Intergenic
904029913 1:27527657-27527679 CGCTGGAGGCAGATGGCGCAGGG + Intergenic
904918985 1:33991700-33991722 AGCTCTAGGCAGAGGGACCTTGG + Intronic
908679461 1:66643745-66643767 AGCTTTAGTGAGATTGAACAGGG + Intronic
909037723 1:70613283-70613305 AGCTTTGGGGAGATGAAGGAAGG + Intergenic
909619944 1:77656391-77656413 TTCTTAAGACAGATGGAGCATGG - Intronic
910667657 1:89742066-89742088 AGCTATAGGCAGATGATTCAAGG + Intronic
912665610 1:111576829-111576851 AGCTTTAGGAAGCGGGAGTATGG + Intronic
913050545 1:115113539-115113561 AGCTTGAGGAAGATGGAGCGGGG - Intergenic
913245758 1:116868714-116868736 ACCATAAGGCAGGTGGAGCATGG + Intergenic
913305338 1:117424692-117424714 AGGCTGAGGCAGATGGAGGATGG - Intronic
914870529 1:151470288-151470310 AGCAGTGGGCAGATGGAGAAGGG - Intergenic
915288762 1:154869248-154869270 GGCATTAGGGTGATGGAGCAGGG + Exonic
916018274 1:160769985-160770007 AGATTGAGCCAGATGGAGAAAGG + Intergenic
916336181 1:163673409-163673431 AGGTACAGGCAGATGGAGAAAGG - Intergenic
918862602 1:189851092-189851114 AGCTTTAGGCAGGTGTAGGTGGG + Intergenic
920056964 1:203199754-203199776 AGCCTTAGGGAGATGGAAGAGGG - Intergenic
922292360 1:224218999-224219021 AGCTGAAAGCAGATGGAGGAGGG + Intergenic
1063426114 10:5951399-5951421 AGCATTTGGGAGATGGGGCATGG - Intronic
1064562703 10:16608462-16608484 AGCTTTAGGCAGAAGCAGCTCGG + Intronic
1067662507 10:48246968-48246990 CGCTCTAGGCATATGAAGCATGG - Intronic
1070589898 10:77794285-77794307 AGCTCTGGGCAGATGGGGGAAGG + Intronic
1070729065 10:78812729-78812751 AGCATTAGGCAGATGGGAGAGGG + Intergenic
1072225751 10:93367394-93367416 AGCTTTTGGCTGAAGGAGAAAGG + Intronic
1072583574 10:96761655-96761677 AGATTTATACATATGGAGCAGGG - Intergenic
1074268798 10:111931910-111931932 AGCATTATACAGATGGACCATGG + Intergenic
1078110108 11:8385444-8385466 TGTTTTAGGCAGAGGGAACAGGG - Intergenic
1078879110 11:15430500-15430522 AACTTTATGCAGATGCAGCCCGG - Intergenic
1079315764 11:19406724-19406746 GGCTATAGGGAGATGGGGCAGGG - Intronic
1081766683 11:45616080-45616102 TGCTTTCGGGAGGTGGAGCAGGG - Intergenic
1082056082 11:47817579-47817601 AGGCTGAGGCAGATGGATCACGG - Intronic
1083050129 11:59769590-59769612 AGCTTTGTGCAGATGTAGCCAGG - Intronic
1085454853 11:76660040-76660062 CGCTTGAGGCAGATGAAGCAGGG + Exonic
1086588385 11:88482624-88482646 ATGTTTAGGCAGATTGAGGAGGG + Intergenic
1088836136 11:113579207-113579229 AGGTTTAGGTGTATGGAGCAGGG - Intergenic
1090277883 11:125432378-125432400 AGCTGGAGGCTGATGGAGCCAGG - Exonic
1091600508 12:1915197-1915219 AGCTTTAGGGACAAGGAGGAGGG - Intronic
1093094466 12:14957114-14957136 AGATTGAGTCAGATGGACCAGGG + Intronic
1095235763 12:39793649-39793671 TGCGTTAGGTAGATGGAGCTGGG + Intronic
1097277133 12:57821304-57821326 GGCTTCATGCAGATGCAGCAGGG + Exonic
1097491686 12:60279450-60279472 AGTTTCAGGCAGAGGCAGCATGG + Intergenic
1098154497 12:67583406-67583428 TGCTTTATGCAGTGGGAGCAAGG + Intergenic
1098465759 12:70784081-70784103 AGCTGAGGGCAGAGGGAGCAGGG + Intronic
1100025497 12:90122656-90122678 AGTTATAGGCAGCTGCAGCATGG - Intergenic
1100619363 12:96256477-96256499 AGCTTCATGAAGTTGGAGCATGG + Intronic
1100708765 12:97230997-97231019 AGCTTAAGGCAGGTGGCCCAGGG + Intergenic
1102457950 12:113082412-113082434 AGCTTTAGGCGGAAGAAGCCAGG - Intronic
1104745741 12:131209375-131209397 AGATTGAGGCAGATGGAGATGGG - Intergenic
1106644282 13:31616107-31616129 AGCTTCATGCAAATGTAGCAAGG + Intergenic
1107068440 13:36243137-36243159 AGGTTTGGGCAGAGGGAGTAGGG - Intronic
1108123246 13:47212586-47212608 TGGTGTAGGAAGATGGAGCAGGG + Intergenic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1113630600 13:111880443-111880465 TCCTGTAGGCAGATGGAGCGGGG + Intergenic
1114620127 14:24090827-24090849 AGCTTTAGGCAGATGGAGCAAGG - Intronic
1118669697 14:68110408-68110430 ATCTTGAGACAGATGGAGAAAGG - Intronic
1121560939 14:94874860-94874882 AGGTTTAGGAAAATGCAGCAGGG - Intergenic
1121626384 14:95388472-95388494 AGCTTCAGGCAGAAAGAGCATGG - Intergenic
1121679376 14:95779984-95780006 AGCTTTAGGAAGATAAATCATGG - Intergenic
1121784897 14:96649945-96649967 AGTTTTAAGCAGTTGCAGCAGGG - Intergenic
1122355231 14:101119307-101119329 AGCTTTAATCAGCTTGAGCAAGG + Intergenic
1122455987 14:101851643-101851665 AGCATTACCCCGATGGAGCAAGG - Intronic
1123118940 14:105908221-105908243 AGCTGTGGGCAGGAGGAGCACGG + Intergenic
1124094704 15:26638253-26638275 ATATCTAGGCAGATGCAGCAGGG + Intronic
1128065618 15:64762818-64762840 AGCTCTGAGCAGATGGAGGATGG - Intronic
1129815742 15:78551818-78551840 AGCTTTAGGCAAATGTTGAAGGG - Exonic
1131289874 15:91098520-91098542 AGCTCTGGGCACATGGAGCAGGG + Intergenic
1133316819 16:4890080-4890102 AGCCTTTGGGAGGTGGAGCAGGG - Intronic
1133661410 16:7921512-7921534 TGCTTAAGGCAGTTGGAGCTGGG + Intergenic
1134222111 16:12362996-12363018 AGACTTGGGCAGAGGGAGCATGG - Intronic
1134416324 16:14046613-14046635 ACCTTTAGGGCGGTGGAGCAGGG - Intergenic
1137832133 16:51554045-51554067 AGCTTTAGGGAGTTGAAGTAGGG + Intergenic
1141678500 16:85530309-85530331 AGCCAGAGGCAGAGGGAGCAAGG + Intergenic
1142467006 17:141835-141857 AGGGTTAGGCAAAAGGAGCATGG - Intergenic
1143039465 17:4022975-4022997 AGCTTTTGGAAGTTAGAGCAGGG - Intronic
1143369287 17:6428454-6428476 AGCCTGAGGCAGATGGCCCAGGG - Exonic
1144846885 17:18224861-18224883 AGCTTTACGGAGATGGGGGAAGG - Intergenic
1145029379 17:19493099-19493121 AGCTGTAGCCACCTGGAGCAAGG + Intergenic
1146630139 17:34463763-34463785 TGCTTGAGCCAGGTGGAGCAGGG - Intergenic
1149630363 17:58116817-58116839 AGGTCTGGGGAGATGGAGCATGG - Intergenic
1152820686 17:82436196-82436218 AGCCTCAGGCAGAGCGAGCAGGG - Intronic
1153113534 18:1624674-1624696 ATCTTTAGCGAGATGGATCAAGG - Intergenic
1153626353 18:7025295-7025317 CGTTCTAGGCAGATGGAGCTGGG - Intronic
1153814309 18:8779614-8779636 AGGTCGAGGCAGCTGGAGCAGGG - Intronic
1154025142 18:10699750-10699772 AGCTTTTGGCAGATGGACTAAGG + Intronic
1154373567 18:13789287-13789309 ACCTTTAGGTAGATTGACCAAGG - Intergenic
1155355110 18:24944271-24944293 GGCTTTAGGCAGAAGGAGGAGGG + Intergenic
1155377558 18:25176974-25176996 AGATGTAGGCAGAAGGAGAAGGG - Intronic
1155410707 18:25541767-25541789 ATCCTTGGGCAGATGGAGCTAGG + Intergenic
1162385321 19:10357510-10357532 AGTTTTAGGCAGAGTGACCAGGG - Intronic
1165096841 19:33414126-33414148 AGCTATGGGCAGAAGGGGCAAGG + Intronic
1166326073 19:42051920-42051942 AGCTTTAGGAGGCTGGAGGAAGG - Intronic
926118904 2:10230415-10230437 AACTGAAGGCAAATGGAGCAAGG + Intergenic
927186337 2:20485192-20485214 AGCAGTGGGGAGATGGAGCATGG + Intergenic
929039645 2:37731502-37731524 AACTTTAGTCACCTGGAGCAGGG - Intronic
930916416 2:56694726-56694748 ACCTTTAGCCAGATTGATCAGGG + Intergenic
932095720 2:68846674-68846696 ATCTTTAACCAAATGGAGCACGG + Intergenic
932335442 2:70928478-70928500 AGTCAGAGGCAGATGGAGCAGGG - Intronic
933610511 2:84429689-84429711 AGCTAAAGGCAGATTTAGCATGG - Intronic
935707243 2:105867787-105867809 ATCTTTAGGAAGCTGAAGCAGGG - Intronic
936502067 2:113074437-113074459 GGCCTATGGCAGATGGAGCATGG - Intronic
937583454 2:123517073-123517095 AGCTTTGGGCACAAGGAGAAAGG + Intergenic
939397850 2:141654406-141654428 AGCTTCAGGCAGTTCAAGCAAGG - Intronic
942779111 2:179620049-179620071 AGGTTTAGGCAAAAGGAGAAAGG - Intronic
943049713 2:182900170-182900192 AGCTGAAGGCACCTGGAGCATGG - Intergenic
946337837 2:219050159-219050181 GGCTCTAGGCTGAGGGAGCAGGG + Intergenic
947112795 2:226737686-226737708 AGCTCTAGACACATGGAGGATGG + Intronic
1168919739 20:1521402-1521424 AGCATTATGCAGAAGGAGGATGG + Intergenic
1170300564 20:14880215-14880237 AGTTTTGGGGAGAGGGAGCATGG + Intronic
1170835219 20:19878216-19878238 AGCTTTGGGCATTGGGAGCATGG - Intergenic
1172998654 20:39090041-39090063 AGAGTTGGGAAGATGGAGCATGG + Intergenic
1173279188 20:41612800-41612822 AGCTTTAGGCAGATTGCGAAGGG - Intronic
1175207421 20:57322043-57322065 AGCTCCAGGCAGAGGGAGCGAGG - Intergenic
1175980856 20:62737933-62737955 AGCTTTACGCAGAGGCTGCAGGG - Intronic
1177033852 21:16016814-16016836 AGCTGTAGGTAGATGGACAAGGG + Intergenic
1177803573 21:25852073-25852095 AGCTTTGGGCATATGTAGAAAGG - Intergenic
1178470155 21:32885343-32885365 TGCTTTAGGAAGAGGGAGTAGGG - Intergenic
1179625245 21:42645597-42645619 AGCTTTGTACAGAAGGAGCAAGG + Intergenic
1180055963 21:45359425-45359447 AGCTTTAGGCACTTGGAGGGCGG + Intergenic
1182441758 22:30368721-30368743 AGCTTTTTGCAGATGCAGGAGGG - Intronic
1183669657 22:39264911-39264933 AGATTTGGTCAGATGGAGGAGGG - Intergenic
1185346970 22:50314699-50314721 AGCTGTGGGCAGAGGCAGCAGGG + Exonic
1203291929 22_KI270736v1_random:3080-3102 AACTTTAGTCATCTGGAGCAGGG - Intergenic
949451794 3:4193606-4193628 AGCTATAGCCAGGAGGAGCAGGG + Intronic
950980731 3:17301784-17301806 AGATTTAGGTAGGTGGAGCCAGG + Intronic
956585010 3:70854909-70854931 ATCTTGAGGCAGAAGGAGCAAGG + Intergenic
957644165 3:82898656-82898678 AGACTTAGGCAGACAGAGCAGGG - Intergenic
958855220 3:99376750-99376772 AGCTTTAAGCAGCTACAGCAAGG + Intergenic
959619519 3:108385056-108385078 AGCTTCAGGCAGATATAGCTTGG - Intronic
960718372 3:120600590-120600612 AGCTGTAGGAAGATGAAGGAGGG - Intronic
961219158 3:125186402-125186424 ATTTTTAGGCAGCAGGAGCAGGG - Intronic
962823291 3:139074025-139074047 AGCTTTAGGCAGCTACAGCAAGG + Intronic
962986561 3:140541615-140541637 ACATCTAGGCAGATGGACCACGG - Intronic
964848341 3:161067869-161067891 TGCTGTAGGCAGATGGAGAAGGG - Intronic
966660242 3:182406506-182406528 AGGTTTATGCAGATTGATCACGG - Intergenic
969166263 4:5318360-5318382 AGTGATAGGAAGATGGAGCAGGG + Intronic
971844189 4:31897411-31897433 AGCTGTTGGCTGATGAAGCAGGG + Intergenic
972547639 4:40095670-40095692 AGATTGGGGCAGAGGGAGCAGGG + Intronic
975472825 4:74790587-74790609 TCCTTTGGGCAGATGGAGAAGGG - Intronic
976118301 4:81751860-81751882 AGTTTTGGGCGGATGGAGCAGGG - Intronic
976858384 4:89631106-89631128 ACCTTTAGCCAGATGGAGCTTGG - Intergenic
978170126 4:105659638-105659660 TGCATCAGGCAGGTGGAGCAAGG - Intronic
980189636 4:129507429-129507451 ATCTTTGGGCAGATGGTGAATGG + Intergenic
982226274 4:153170409-153170431 AGCTTCAGGCTGATGGTGCAGGG + Intronic
982781790 4:159498804-159498826 TGCTTGAGGCAGATCAAGCAGGG + Intergenic
982971626 4:161995542-161995564 AGCCTTAAGCAGACGGACCAGGG + Intronic
983398240 4:167231076-167231098 AGCTTTAGGAACAAAGAGCATGG - Intronic
984595195 4:181658842-181658864 AGCTTGTGGGAGATGGAGCCAGG + Intergenic
985104716 4:186489295-186489317 ATCTTTAGGCAGATAGTGCTGGG - Intronic
990238720 5:53795695-53795717 TTCTCTGGGCAGATGGAGCAGGG - Intergenic
990570223 5:57071036-57071058 GCTTTTAGGCAGATGGAGGAAGG + Intergenic
992986327 5:82234209-82234231 ACTTTTAGGCAGATGGGGGAGGG + Intronic
994326223 5:98448625-98448647 AGCTTTGGGCAGATGCAGGTGGG - Intergenic
995385195 5:111581076-111581098 AGCTTTAATCAGATGGAAGAGGG - Intergenic
995809889 5:116093612-116093634 AGTCTTAGGTAGCTGGAGCACGG + Intronic
996725991 5:126673761-126673783 GGCTTTTGGCATATGAAGCAAGG + Intergenic
997501453 5:134377955-134377977 AGGCTTAGGCAGGTGGATCATGG + Intronic
1001383211 5:171317427-171317449 AAGTCTAGGCAGATGGAGCCAGG - Intergenic
1002047904 5:176552350-176552372 TGGTTTAGGCAAATGGAGGAAGG + Intronic
1002827199 6:784610-784632 AGCTTCAGGCAGCTGGAGCAAGG - Intergenic
1004607503 6:17207534-17207556 AGCTGATGACAGATGGAGCAAGG + Intergenic
1005650179 6:27878778-27878800 GGCTTCATGCAGATGCAGCAGGG + Intergenic
1005902174 6:30226406-30226428 AGTTTTTGGCAAATGAAGCATGG + Intergenic
1007789624 6:44301589-44301611 AGCTCTAGGCAGAGGTGGCAGGG + Intronic
1011366588 6:86588788-86588810 AGCAGGAGGCAGAAGGAGCAGGG + Intergenic
1011982790 6:93404020-93404042 AGTATCAGGCAGAGGGAGCAGGG + Intronic
1014294625 6:119603594-119603616 AGCCTTAGGCTGTTGGAGCTGGG - Intergenic
1017786752 6:157762950-157762972 CGCTTTAGGCAAATAGAGCGAGG + Intronic
1018278087 6:162154075-162154097 AGCTTTATGCTGATGGAGACAGG - Intronic
1018576701 6:165267010-165267032 AGCTTCAGGTAGCTGTAGCATGG + Intergenic
1019087630 6:169495541-169495563 AGCTTTAGCCAGGTGGATTAAGG + Intronic
1019633897 7:2065223-2065245 AGCTGAAGGCAGATGGAGACTGG - Intronic
1021621999 7:22557820-22557842 AGCAATAGGCTGATGGAACAGGG - Intronic
1022789035 7:33668540-33668562 AGCTTTAGGAACACTGAGCAGGG + Intergenic
1024404690 7:48964715-48964737 AGATTATGGCAGATGGAGGATGG - Intergenic
1028639569 7:93028144-93028166 AGGTTGAGGCAGGTGGATCATGG + Intergenic
1028925849 7:96356206-96356228 AGTTTTAGGCACTTGGAACACGG - Intergenic
1030461210 7:109839228-109839250 GGCTTCATGCAGATGCAGCAGGG - Intergenic
1031301826 7:120069561-120069583 AGCTGTAGGCACAGGGAACAAGG - Intergenic
1031333406 7:120495762-120495784 AGCTTAAGGTAGGTGGGGCAGGG - Intronic
1031479734 7:122264297-122264319 AGCTTTATCCAACTGGAGCATGG - Intergenic
1032619293 7:133511528-133511550 ACTTTTAGGCAGATGGGGGAGGG + Intronic
1033014666 7:137660523-137660545 AGCTTTAGACCACTGGAGCAGGG + Intronic
1033344570 7:140517398-140517420 ACCTTTAGGGAGCGGGAGCAAGG - Intergenic
1035304552 7:157923375-157923397 AGGCTCAGGCAGGTGGAGCATGG - Intronic
1036953194 8:13160788-13160810 AGATTTAGGAAGGTGGAGCCGGG + Intronic
1037422887 8:18722761-18722783 AGATTTAGGCAGATGGAAGGGGG - Intronic
1038119048 8:24591346-24591368 AGCTTTAGAACTATGGAGCAGGG + Intergenic
1039470299 8:37809322-37809344 AGTTTTAGACAGATAGTGCAGGG - Intronic
1042964666 8:74337644-74337666 AGCTTTCAGCAGATGCAGCAAGG + Intronic
1043097465 8:75993946-75993968 AGTTGTAGGCTGATGGAGCAAGG - Intergenic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1046157602 8:110313503-110313525 AGCTTTAGCCATATGGATCCAGG - Intergenic
1047411952 8:124631170-124631192 AGCTTTGGGAAGGTGGGGCACGG + Intronic
1052902621 9:33807128-33807150 AACTTTACGCAGATGAAGCTTGG + Intergenic
1053432526 9:38052571-38052593 TGCTTTAGGCAGAGGCACCAAGG - Intronic
1055508481 9:76971301-76971323 GGCTGTAGGCAGCTGGAGAAAGG + Intergenic
1055673105 9:78626948-78626970 AGGCTCAGGCAGATGAAGCAGGG - Intergenic
1055761542 9:79614153-79614175 TGCTTTATGGAGATGGAGAATGG + Intronic
1057673444 9:97116786-97116808 AACTTTACGCAGATGAAGCTTGG - Intergenic
1057894806 9:98900515-98900537 AGCTGTCAGCAGAAGGAGCAGGG + Intergenic
1057978069 9:99628141-99628163 AGGTATGGGTAGATGGAGCAGGG - Intergenic
1058495531 9:105554856-105554878 AGCTTCAGGCTGATGAGGCAAGG - Intergenic
1058901896 9:109449285-109449307 AACTTCATGCAGATGGAGCTTGG - Intronic
1059727580 9:117024626-117024648 AGCTTTGGGCACACAGAGCAGGG + Intronic
1059820347 9:117965898-117965920 AGCATGAAGCAGATGCAGCAGGG - Intergenic
1060212441 9:121718856-121718878 AGCTTTAAGCAGAAGGAGCTAGG - Intronic
1062013692 9:134280628-134280650 ATCTTTGGGCAGCAGGAGCAAGG + Intergenic
1203653667 Un_KI270752v1:2911-2933 AGCTTTAGGCAGGTGCTGTAAGG + Intergenic
1186642994 X:11476177-11476199 AGCTATAAGTAGATTGAGCATGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188524093 X:31071130-31071152 AGCTGCATGCAGATGGGGCAGGG + Intergenic
1188770495 X:34147841-34147863 AGCTGCATGCAGATGGGGCAGGG - Intergenic
1189035828 X:37492808-37492830 AGCTGCATGCAGATGGGGCAGGG - Intronic
1189037309 X:37506120-37506142 AGCTGCATGCAGATGGGGCAGGG - Intronic
1190302576 X:49065240-49065262 ACCCATAGGAAGATGGAGCATGG - Intronic
1195579372 X:106483959-106483981 AGCTATAGGCATAGGGAGAAGGG - Intergenic
1195911156 X:109889791-109889813 AACTTTAGGGAGATTGAACAGGG - Intergenic
1196306647 X:114110985-114111007 AGCTTGAGGAAGGTAGAGCATGG + Intergenic
1196804627 X:119573855-119573877 AGCTTAAGGCAGGCGGAGTAGGG - Intergenic
1197730259 X:129803797-129803819 AGCTTGAGGAAGAAGGAGGAAGG + Exonic
1198827782 X:140717215-140717237 AGCCTGAGGCAGGTGGATCACGG - Intergenic