ID: 1114624474

View in Genome Browser
Species Human (GRCh38)
Location 14:24119843-24119865
Sequence TGTCCAGCCAGTGCACCCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114624474_1114624479 12 Left 1114624474 14:24119843-24119865 CCTGTGGGTGCACTGGCTGGACA 0: 1
1: 0
2: 1
3: 15
4: 127
Right 1114624479 14:24119878-24119900 CACCTTCATTGACAGCAAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 146
1114624474_1114624478 9 Left 1114624474 14:24119843-24119865 CCTGTGGGTGCACTGGCTGGACA 0: 1
1: 0
2: 1
3: 15
4: 127
Right 1114624478 14:24119875-24119897 CATCACCTTCATTGACAGCAAGG 0: 1
1: 0
2: 2
3: 10
4: 161
1114624474_1114624482 25 Left 1114624474 14:24119843-24119865 CCTGTGGGTGCACTGGCTGGACA 0: 1
1: 0
2: 1
3: 15
4: 127
Right 1114624482 14:24119891-24119913 AGCAAGGTGGGCCAGAAGTCAGG 0: 1
1: 0
2: 1
3: 25
4: 256
1114624474_1114624480 13 Left 1114624474 14:24119843-24119865 CCTGTGGGTGCACTGGCTGGACA 0: 1
1: 0
2: 1
3: 15
4: 127
Right 1114624480 14:24119879-24119901 ACCTTCATTGACAGCAAGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114624474 Original CRISPR TGTCCAGCCAGTGCACCCAC AGG (reversed) Exonic
900474609 1:2870264-2870286 TCTCCACCCAGTGCAGCCCCCGG + Intergenic
900601821 1:3505983-3506005 GGCCCAGCCAGGTCACCCACTGG - Intronic
900775802 1:4584601-4584623 CGTCTAGCCAGGGCACCCACTGG + Intergenic
903260369 1:22128591-22128613 TGTCCACCCTGTGCTTCCACAGG + Intronic
904337241 1:29805900-29805922 TGTCCAGCCTGTCCACACAGTGG - Intergenic
904622789 1:31785260-31785282 TGGCCAGCCTGTGCACACACTGG + Intergenic
906815753 1:48876565-48876587 TGCCCACCCAGTGCACCCATGGG + Intronic
908395500 1:63721819-63721841 AGTCAAGCAAGTGCCCCCACTGG - Intergenic
909283965 1:73791096-73791118 TGTCCAACCCCTGCACCCCCAGG + Intergenic
912625223 1:111200607-111200629 TTTCCATCCTGTGCACCCAGTGG + Exonic
918116472 1:181502422-181502444 TGTCCTGCCAGGGCAGCCATAGG + Intronic
924200910 1:241657519-241657541 TGCCAAGCCTGTGCAGCCACAGG + Intronic
1067280007 10:44864177-44864199 TGCCAAGCCTGCGCACCCACGGG + Intergenic
1067433050 10:46256540-46256562 TGGGAAGCCAGTACACCCACAGG + Intergenic
1067440215 10:46304884-46304906 TGGGAAGCCAGTACACCCACAGG - Intronic
1067830485 10:49609045-49609067 TCTCCCGCCAGTCCGCCCACTGG + Intergenic
1068870699 10:61940844-61940866 TGTCAAGCCAGGGGATCCACTGG + Intronic
1070675292 10:78407730-78407752 TGTCAAGACAGTGCACCCCTGGG + Intergenic
1073317242 10:102591721-102591743 TGTCCAGCCTATGCATCCACAGG - Intronic
1074853072 10:117454291-117454313 TCCCCAGCCAGTGCAGCCTCTGG - Intergenic
1075714424 10:124547933-124547955 TGTCCAGGCAGGGCAGCCTCTGG + Intronic
1076420640 10:130329116-130329138 TGTGCAGCCTGTTCACCCTCTGG + Intergenic
1077106178 11:843512-843534 GGTCCTGCCAGTGCAGCCTCCGG - Intronic
1081628579 11:44671596-44671618 TTTGCACCCTGTGCACCCACAGG - Intergenic
1084631190 11:70352058-70352080 TGTCCAGTCACTGCACCATCAGG - Intronic
1084666501 11:70579248-70579270 TTTCCAGCCAGTGAGCTCACTGG + Intronic
1090260363 11:125314807-125314829 TGTCCAGCCAGGGCTGCCCCGGG - Intronic
1090631912 11:128656976-128656998 TGTGCAGCCACAGCACCCAAAGG - Intergenic
1096514326 12:52147870-52147892 TGTCCAAACTGTGCACCCACTGG + Intergenic
1097109271 12:56646055-56646077 TGAGCAGCCAGTTCACCCAATGG - Exonic
1098528196 12:71511056-71511078 TGTGCAGCTAGTGAACCAACAGG + Intronic
1101569120 12:105936934-105936956 TGTCAAGCAAGGGCACCCAAAGG + Intergenic
1104833500 12:131771409-131771431 ACTCCAGTGAGTGCACCCACGGG + Intronic
1112440752 13:99423091-99423113 CGTTCACCCAGTGCACACACTGG - Intergenic
1114624474 14:24119843-24119865 TGTCCAGCCAGTGCACCCACAGG - Exonic
1119810934 14:77518874-77518896 TGTCAGGCCAGTTCACCCGCTGG + Intronic
1119850659 14:77864253-77864275 TGCCCTCCCACTGCACCCACAGG - Intronic
1122051902 14:99066438-99066460 TGCCCAGCCATTGTTCCCACAGG - Intergenic
1122204326 14:100141142-100141164 TCTCCAGCCAGGGCACCCACAGG + Intronic
1123765795 15:23477509-23477531 AGTCCACCCAGTGCACCACCTGG - Intergenic
1124148275 15:27151811-27151833 TGTCCAGACAGTGCTCCTTCTGG - Intronic
1128376066 15:67076870-67076892 TGCCCAGCCATTGGTCCCACAGG - Intronic
1129243094 15:74263225-74263247 TGTCCAGCCTGAGCTCCCCCAGG - Intronic
1129392914 15:75229468-75229490 AGTCCACCCAGTGCTCCCCCTGG + Intergenic
1130061226 15:80571579-80571601 TTTCCAGCCAGTCCCTCCACTGG - Intronic
1132592687 16:733186-733208 ACTCCAGCCAGGGCCCCCACAGG + Intronic
1141662910 16:85451266-85451288 CCTCCAGCCCCTGCACCCACGGG + Intergenic
1142957205 17:3530129-3530151 TGTCCAGGAAGTTCACCGACTGG - Exonic
1143368314 17:6422682-6422704 TGTCCAGCCAGGGAGCCCACAGG + Intronic
1144944256 17:18961729-18961751 GGTCCATCCAGAGCCCCCACGGG + Intronic
1146654490 17:34626911-34626933 TGTCCAGCCTGTGCTCCTGCAGG - Exonic
1147322671 17:39655878-39655900 TTTCCAGCCTGGGCACCCACCGG - Intronic
1147909773 17:43848612-43848634 TGTCCCTGCAGTGCACCTACAGG + Exonic
1150242472 17:63646167-63646189 TACCCAGCCAGTGGCCCCACAGG - Intronic
1151034198 17:70779508-70779530 TCTCCAGGCAGTTCCCCCACTGG - Intergenic
1151082909 17:71349168-71349190 TGTACAGCCTGTGGAACCACGGG - Intergenic
1152745429 17:82036569-82036591 TCTCCAGCCAGTGCTCCCAGCGG - Exonic
1156377870 18:36531025-36531047 TGTCCAGCCAGGCCAGCCATTGG - Intronic
1156522055 18:37730283-37730305 TTTTCAGCCAGTGCACACAGCGG - Intergenic
1157251222 18:46098030-46098052 TGTCCAGCCGGAGAAGCCACGGG + Intronic
1159143076 18:64420491-64420513 TGTCCAAACAGAGGACCCACTGG - Intergenic
1160426779 18:78783285-78783307 TCTCCAGCCAGCCCACCCTCCGG - Intergenic
1161737724 19:6001906-6001928 TGTCCAGCCAGCTGGCCCACTGG + Exonic
1161857207 19:6772815-6772837 TGTGGCGCCAATGCACCCACTGG + Exonic
1163546441 19:17943726-17943748 TGGGGAGCCAGTTCACCCACGGG + Exonic
1164388701 19:27798132-27798154 TGTCCTGGCATTGCATCCACAGG + Intergenic
1165821355 19:38678374-38678396 TGGCCAGCCAGTCAAACCACAGG - Intronic
925047064 2:780520-780542 CTTCCAGCAAGTGCAGCCACAGG + Intergenic
928452470 2:31388786-31388808 TGTCCAGCCAGTGTGCCCAATGG + Intronic
929782014 2:44963017-44963039 TGTCCAATCAGAGCAGCCACAGG + Intergenic
929855841 2:45638098-45638120 TTTCCAGCCATTTGACCCACTGG - Intergenic
931189087 2:59982410-59982432 CTTCCAGCCAGTGGACACACAGG + Intergenic
931304886 2:61018220-61018242 TGTCCAGCCACGGCATCGACAGG + Exonic
932671587 2:73741867-73741889 AGTCCAGCCTCTGCACCCACAGG + Intergenic
933135607 2:78730814-78730836 TTTCCATCCAGTGTACTCACTGG + Intergenic
936286951 2:111188186-111188208 TGTGCAGCCAGGGCAGCCTCTGG + Intergenic
936909685 2:117577159-117577181 AGTCCAGCCAGTGGTCTCACTGG + Intergenic
948583765 2:239005506-239005528 TGTCCAGCCCAAACACCCACAGG - Intergenic
948746226 2:240095908-240095930 CGTCCAGCCCCTGCACCCGCGGG - Intergenic
1169018401 20:2310300-2310322 AGTCCTGCCAGCGCACCCATAGG + Exonic
1169182216 20:3579617-3579639 TGTCCACCCAGTGCTCTCAGGGG + Intronic
1169479467 20:5965271-5965293 TGTCCAGCCAGTTCCAGCACTGG - Intronic
1170725306 20:18920771-18920793 TGTACAGCCTGTGGAACCACAGG + Intergenic
1174042304 20:47708688-47708710 TCTCCAGCCAGTGAACCTACTGG + Intronic
1174910548 20:54603302-54603324 TTTCCAGCGAGTACACACACGGG + Intronic
1176419293 21:6501070-6501092 TGTCCAGAAAGTGCAGCCTCAGG + Intergenic
1178046743 21:28703351-28703373 TGTCCAGCCAGCGATCCTACAGG - Intergenic
1179694786 21:43109392-43109414 TGTCCAGAAAGTGCAGCCTCAGG + Intergenic
1179878545 21:44283883-44283905 TGTGCAGCCAGTGGGCCCAAGGG + Intergenic
1180079726 21:45481117-45481139 TGTGCAGTCCGTGGACCCACAGG - Intronic
1180709496 22:17830240-17830262 TGTCCAGCCACTGCCTGCACAGG + Intronic
1181871058 22:25899689-25899711 GGTTCAGCCAGAGCACCCACAGG - Intronic
1182782683 22:32880642-32880664 TTGCCAGCCAGTGCCCCCAGCGG - Intronic
1183520844 22:38295300-38295322 TGTCCAGCCACTGCCGCCCCTGG + Intronic
1183684591 22:39354420-39354442 TATCCAGGCAGAGAACCCACAGG - Intronic
950482664 3:13254309-13254331 TGTCCAGCCTGGGCACCTCCTGG - Intergenic
950499368 3:13354078-13354100 TGTCCAGCCACCGCAACCCCCGG - Exonic
961601953 3:128069287-128069309 TGTCCAGGCAGTGGCCACACTGG - Intronic
961608294 3:128114805-128114827 TGTCCAGCCTGTGGCCCCACGGG - Intronic
963813856 3:149808362-149808384 TGGCCAGCGATTTCACCCACAGG - Intronic
969987606 4:11227649-11227671 TGTCCAGCCAGTGTCACCATTGG + Intergenic
975886466 4:78971923-78971945 TGTCAAGCTAGTTCACACACAGG + Intergenic
980401557 4:132293680-132293702 TCTGCAGCAAGTTCACCCACTGG + Intergenic
982222122 4:153134037-153134059 AGTCCAGCCAGGGCACCCTTTGG - Intergenic
984331508 4:178326284-178326306 TGTCCAGCCAATTCACCCCAAGG - Intergenic
986446532 5:7825962-7825984 TTTCCTGCCATTGCACCGACAGG - Intronic
986645653 5:9913807-9913829 TGTCCAGACAGTGCTCACACTGG - Intergenic
988744720 5:34123118-34123140 GGTCCAGGCAGAGAACCCACAGG + Intronic
997191471 5:131940762-131940784 TGTCCGGCCAGTGTCCACACTGG + Intronic
997690816 5:135826293-135826315 TGTTCAGCCACTCCACCCCCAGG + Intergenic
999487801 5:152016796-152016818 TCTCCAGTCAGGGAACCCACTGG + Intergenic
999831595 5:155325393-155325415 TGCCCAGCCATTGCACCATCTGG - Intergenic
1000246681 5:159454036-159454058 TCTCCTGCCAGTGCCTCCACTGG + Intergenic
1003893522 6:10584979-10585001 TGTCCTGCCTGTGCCCCCAAGGG + Intronic
1004218097 6:13720716-13720738 ATTCCAGCCACTGCACCCATAGG - Intergenic
1006792914 6:36715491-36715513 GCTCCAGCCAGAGCCCCCACAGG + Exonic
1010818703 6:80388969-80388991 TGACCAGCCAGTGAAACCATTGG - Intergenic
1010938170 6:81885859-81885881 TGACCAGCCAGTGAAACCATTGG + Intergenic
1019303450 7:321352-321374 TGTCAAGCCAAGTCACCCACAGG - Intergenic
1019738630 7:2662277-2662299 TGTGCAGCCCGCCCACCCACAGG + Exonic
1022963205 7:35449908-35449930 TGTCCAGCCATCACACTCACGGG + Intergenic
1025718091 7:63982667-63982689 AGTTCAGCCAGTGCCCCCAGAGG + Intergenic
1031401246 7:121328632-121328654 TTTCCAGCCACTACACCCAGAGG + Intronic
1033261166 7:139845193-139845215 TGTCCTGCAACTGCAGCCACCGG + Intronic
1035005635 7:155657651-155657673 GCTCCAGCCACTGCACCCAGTGG + Intronic
1037000186 8:13707929-13707951 TGTACAGCCAGTGAACCTGCTGG - Intergenic
1039996144 8:42535152-42535174 TGGCCAGGCAGTCCACTCACAGG + Intronic
1042132747 8:65604819-65604841 TGTCTAGCCACTGCAGCCACTGG + Intronic
1047447887 8:124936544-124936566 TGAGCAGCCCGTGAACCCACCGG - Intergenic
1047470760 8:125169642-125169664 TGTGCAGCCAGTGTGCCCAAGGG - Intronic
1047788502 8:128177726-128177748 TTTCCTGCCAGTACTCCCACAGG - Intergenic
1048866834 8:138767690-138767712 TCTCCAGACAGTGCACCGCCCGG + Intronic
1048968174 8:139628926-139628948 TGTCCACCCAGTGCAACCCTGGG - Intronic
1049601397 8:143509452-143509474 TGGGCAGTCAGGGCACCCACTGG + Intronic
1049651846 8:143773421-143773443 TTTCCAGCCACTGCTCCAACAGG - Intergenic
1055713610 9:79092119-79092141 TGTCCATCCTTTGCAACCACTGG - Intergenic
1056762567 9:89425664-89425686 TGTACAGCCAGTGGGGCCACAGG - Intronic
1061973580 9:134057317-134057339 TGTCCTGCTTGTGCACCCTCTGG - Intronic
1062050154 9:134443011-134443033 TGTGCAGGCAGTGCACACTCAGG + Intergenic
1062382021 9:136291123-136291145 TGCCCAGCCAGTGCACTCCAGGG + Exonic
1062401248 9:136373678-136373700 AGTCCCGCCAGTCCTCCCACAGG + Exonic
1189801806 X:44698501-44698523 TCTCCAGCAAGGGCACCCCCAGG + Intergenic
1198313050 X:135438596-135438618 CCTCCAGCTAGTGCACCCTCTGG - Intergenic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic