ID: 1114626992

View in Genome Browser
Species Human (GRCh38)
Location 14:24136427-24136449
Sequence GAGCACCTGCGCCCCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 225}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114626971_1114626992 29 Left 1114626971 14:24136375-24136397 CCCCCCAGGCTCCCACGCGAGTC 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1114626992 14:24136427-24136449 GAGCACCTGCGCCCCGGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 225
1114626985_1114626992 -6 Left 1114626985 14:24136410-24136432 CCGAGCTGGCGCGCCCGGAGCAC 0: 1
1: 0
2: 2
3: 4
4: 75
Right 1114626992 14:24136427-24136449 GAGCACCTGCGCCCCGGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 225
1114626973_1114626992 27 Left 1114626973 14:24136377-24136399 CCCCAGGCTCCCACGCGAGTCGG 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1114626992 14:24136427-24136449 GAGCACCTGCGCCCCGGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 225
1114626981_1114626992 17 Left 1114626981 14:24136387-24136409 CCACGCGAGTCGGGGGCAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1114626992 14:24136427-24136449 GAGCACCTGCGCCCCGGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 225
1114626975_1114626992 26 Left 1114626975 14:24136378-24136400 CCCAGGCTCCCACGCGAGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 38
Right 1114626992 14:24136427-24136449 GAGCACCTGCGCCCCGGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 225
1114626980_1114626992 18 Left 1114626980 14:24136386-24136408 CCCACGCGAGTCGGGGGCAGTCG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1114626992 14:24136427-24136449 GAGCACCTGCGCCCCGGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 225
1114626972_1114626992 28 Left 1114626972 14:24136376-24136398 CCCCCAGGCTCCCACGCGAGTCG 0: 1
1: 0
2: 1
3: 5
4: 43
Right 1114626992 14:24136427-24136449 GAGCACCTGCGCCCCGGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 225
1114626977_1114626992 25 Left 1114626977 14:24136379-24136401 CCAGGCTCCCACGCGAGTCGGGG 0: 1
1: 0
2: 2
3: 4
4: 67
Right 1114626992 14:24136427-24136449 GAGCACCTGCGCCCCGGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114626992 Original CRISPR GAGCACCTGCGCCCCGGGGA GGG Intronic