ID: 1114627045

View in Genome Browser
Species Human (GRCh38)
Location 14:24136603-24136625
Sequence GGCCCCGGGACCCTCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114627045_1114627054 5 Left 1114627045 14:24136603-24136625 CCCTCAGGGAGGGTCCCGGGGCC 0: 1
1: 0
2: 3
3: 20
4: 227
Right 1114627054 14:24136631-24136653 CATCCCTGTCCTACTTGCAGAGG 0: 1
1: 0
2: 1
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114627045 Original CRISPR GGCCCCGGGACCCTCCCTGA GGG (reversed) Intronic
900131953 1:1091046-1091068 GGACCTGGGCCCCTCCCTGGCGG - Intronic
900204649 1:1426815-1426837 GGCCCCGGGCCCCTTTCTGCTGG + Intronic
900598863 1:3494557-3494579 AGCCCAGGGCACCTCCCTGAGGG + Intronic
900991558 1:6100501-6100523 GGGCCAGCCACCCTCCCTGATGG - Exonic
901494423 1:9613142-9613164 GGCCTCAGGACCCTCCCTGGAGG + Exonic
901644018 1:10706977-10706999 GACCCTGTGACCCTCCCTGCCGG - Intronic
902481996 1:16717006-16717028 GGCCCCAGGACCCTCCTGGGAGG + Intergenic
904587699 1:31589051-31589073 GGCCCCGGGACCCGCCCCGCCGG + Intergenic
906718143 1:47985580-47985602 GGCCCTGGGGCCATCTCTGAGGG - Intronic
911182276 1:94871665-94871687 AGCCCCAGGACTCTTCCTGATGG + Intronic
912286041 1:108370396-108370418 GGCCACGGGATGCTCCCTGGAGG + Intergenic
912467333 1:109883085-109883107 GGCCCCAGGCCCCTCCCTGCTGG + Intergenic
915142606 1:153776586-153776608 GGCCCAGGAACCCACCCTGCTGG + Exonic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
917971356 1:180210104-180210126 AGTGCCTGGACCCTCCCTGATGG - Intergenic
919748573 1:201023327-201023349 CGCCCCGGGTCCCTACCTGACGG + Exonic
922042342 1:221908761-221908783 GGCCCTGTTACCCTGCCTGAAGG + Intergenic
922465732 1:225844792-225844814 GGCACCTGGTCCCTCCATGAGGG - Intronic
922565031 1:226596205-226596227 GTCCCAGAGCCCCTCCCTGATGG - Intronic
1063099166 10:2934764-2934786 GGCCCCGGGAACTTCCCGGTTGG + Intergenic
1067085652 10:43236924-43236946 GGCCCTGAGACCCTCCCACAAGG - Intronic
1069778010 10:70938013-70938035 GGCCCAGGGCTCCTCCCTCAAGG + Intergenic
1069954671 10:72042702-72042724 GACCCAGGGCCCCTCTCTGAGGG + Intergenic
1073043485 10:100622653-100622675 AGCACCAGGACCCTCCCTGCAGG - Intergenic
1073576488 10:104630551-104630573 GGCCAAGGGAGGCTCCCTGAAGG + Intergenic
1074141748 10:110679672-110679694 AGCCCCTGGATCCTCTCTGAAGG + Intronic
1075120291 10:119659601-119659623 GGCAAGGGGACCCTCTCTGATGG - Intronic
1076180453 10:128403023-128403045 GGCCCCGTGACCCTCCATCATGG - Intergenic
1076756958 10:132577549-132577571 GGGCTCAGGCCCCTCCCTGATGG - Intronic
1076761657 10:132608843-132608865 GGCCCAGGGGCCCTCTGTGAGGG + Intronic
1076843900 10:133059781-133059803 GGTCTCAGGGCCCTCCCTGAGGG + Intergenic
1076872046 10:133199044-133199066 GGCCCCGGGGCCACCCCTGCCGG + Exonic
1076888453 10:133273062-133273084 GGGGCCTGGACCCTCCCTCAGGG + Intronic
1076901829 10:133343149-133343171 GGCCGCGGGACCCACTCTGCTGG + Intronic
1077418486 11:2436975-2436997 GGTGGCGGGGCCCTCCCTGAAGG - Intergenic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1077998626 11:7475274-7475296 GGGCCCAGCACCCTCCCTGTGGG - Intergenic
1078374841 11:10785181-10785203 AGCCTCGGGACCCTCCCTTCTGG + Intergenic
1078578891 11:12523762-12523784 GGCCCAGGGCCCCTCTCTGGAGG - Intronic
1079125327 11:17714564-17714586 GCCCCAGGGCCGCTCCCTGAGGG + Intergenic
1083656211 11:64230892-64230914 GGCCCCGCAACCCTCCCTCCCGG + Exonic
1083668176 11:64286307-64286329 GGCCCCAGGCCCCTCACTCAGGG - Intronic
1084170730 11:67399707-67399729 AGCCCAGGGACCCTGGCTGAGGG - Intronic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1084954751 11:72685305-72685327 GGCCCTGGGGCCCTGCCGGAAGG - Exonic
1085122604 11:73976832-73976854 GGCCCCGGAACCCTTCCTCTCGG + Exonic
1095709849 12:45276558-45276580 GGTCACAGGAGCCTCCCTGAGGG - Intronic
1095854242 12:46842824-46842846 GGCCACGGCATCCTCCCTGCTGG + Intergenic
1096616603 12:52836619-52836641 TGCCCAGAGTCCCTCCCTGATGG + Intergenic
1096882920 12:54687218-54687240 GGACCCTGGACCCACTCTGAAGG + Intergenic
1097155983 12:57012692-57012714 GGCCGAGGAACCCTCACTGAAGG + Intronic
1097173061 12:57128257-57128279 GTCCCCGGGACCCTCACTCTTGG + Intronic
1101737220 12:107472056-107472078 GTCCCCAGTATCCTCCCTGATGG - Intronic
1103795287 12:123499170-123499192 GGCCTCGGGACCTTCCCAGGAGG + Intronic
1104931108 12:132339885-132339907 GGGCCCAGGGCCCTTCCTGAGGG + Intergenic
1104953045 12:132451047-132451069 GGCCTTGGGGGCCTCCCTGAGGG - Intergenic
1105000341 12:132686844-132686866 GGGCCGGGGACCCTGCCTGGGGG - Intronic
1106072302 13:26424478-26424500 GGCCCCGGGCCCCACCCGCACGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1118011406 14:61614429-61614451 GCCCCCATGACCCTGCCTGAGGG + Intronic
1119227642 14:72956342-72956364 ACCCCCTGGCCCCTCCCTGATGG + Intronic
1121000921 14:90451605-90451627 GCCATCAGGACCCTCCCTGAAGG + Intergenic
1121422290 14:93824372-93824394 AGCCCAGGGACCCTCCCTGCTGG + Intergenic
1122348417 14:101074260-101074282 GGCCCGGGGACCTGGCCTGATGG + Intergenic
1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG + Intergenic
1124211842 15:27770494-27770516 GGCTCCAGGACCCTCCCCGCAGG + Intronic
1126997635 15:54462754-54462776 AGCCCGAGGAGCCTCCCTGACGG + Intronic
1128418186 15:67466130-67466152 GGCCCCAGCCCCCTCACTGATGG - Intronic
1129392181 15:75226021-75226043 GGGCCCGGGCGCCTTCCTGAGGG - Intergenic
1131257486 15:90871822-90871844 GGCCCCGGGGCCGGCCCCGAGGG + Intronic
1132802784 16:1762508-1762530 GGCTGCGGGATCATCCCTGACGG + Intronic
1132915603 16:2341703-2341725 ACGCCCGGGACCCTCCCTGCAGG - Intergenic
1133033835 16:3023890-3023912 GGCGCTGGGCCCCTCCCTGGGGG + Exonic
1134020236 16:10916321-10916343 GGCCCCAGGACGCTAGCTGATGG + Intronic
1135665751 16:24334464-24334486 TGCCCCAGGACCCTCCGTGTGGG + Intronic
1136505192 16:30698581-30698603 GGCCCCGGGGCCCCGGCTGAGGG - Intronic
1136594913 16:31241574-31241596 GGACCCAGGTCCCACCCTGATGG - Intergenic
1136615859 16:31397988-31398010 GGCCCCTGTGCCCTCCCTGGAGG + Intronic
1138506442 16:57480529-57480551 GGGCCCGGGCCCCACCCTCACGG - Intronic
1138830363 16:60367480-60367502 AGCCCCTGTACCCTCCCTGGAGG - Intergenic
1141079215 16:81035984-81036006 GCCCCCGGGACCCCGACTGAGGG + Exonic
1141469346 16:84228193-84228215 GGCCCTGAGCCCCTCCCAGATGG - Intronic
1141639409 16:85332829-85332851 GGCCCCTGGGCCCGCCATGAAGG - Intergenic
1141797996 16:86287360-86287382 GGCCCCGGGCCCCGCGCTGCTGG + Intergenic
1142140134 16:88469099-88469121 GGCCCCAGGGCCGTCCCTGCCGG - Intronic
1142375052 16:89702188-89702210 TGCCGCGGGCCCCTCCCTCAAGG - Intergenic
1145062008 17:19739464-19739486 GGCCCCAGGACCCTGGCAGAGGG + Intronic
1145747883 17:27333271-27333293 GGCCCCGGGTCCCTCTCTGGAGG - Intergenic
1147629217 17:41919110-41919132 GGCCCCGGGGCCCGCCCTCGTGG - Intronic
1148587437 17:48790956-48790978 GGCCCCAGGACGCTCTCTGCTGG + Intronic
1149894831 17:60421667-60421689 GGCCCCGGGACCCTCGCCCCTGG - Intronic
1151605196 17:75131328-75131350 GCCCCCAGGAGCCTCCCTGCGGG - Intronic
1152362703 17:79839833-79839855 GGCCCCGGGACCCCTGCTGGGGG + Intergenic
1152573312 17:81129808-81129830 GGCCCTCGGACCTTCCCGGATGG - Intronic
1152598531 17:81249890-81249912 GGCATCGGGACCCTGCCTGAGGG + Intronic
1152931436 17:83112096-83112118 GGAGTCGGCACCCTCCCTGAGGG + Intergenic
1152931823 17:83113927-83113949 GACCCCGCGACCCTCCTTGAAGG + Intergenic
1153947108 18:10027721-10027743 GGGTCTGGAACCCTCCCTGAAGG + Intergenic
1156223206 18:35075243-35075265 TGCTCCGGGCCCCACCCTGATGG + Intronic
1156504138 18:37578151-37578173 GCCCCAGGCCCCCTCCCTGAAGG - Intergenic
1157576825 18:48749238-48749260 GGCCTCGGCACCCTGGCTGATGG - Intronic
1157593702 18:48851195-48851217 GGCCCCAGGAGCCTGCCTGCGGG + Intronic
1159775379 18:72598365-72598387 GGCCTCGGGACTCTGCCTGTTGG + Intronic
1160204775 18:76823097-76823119 CGCCCCGGGCTCCTCCCGGACGG + Intronic
1160510037 18:79448277-79448299 GGCCCCAGCACCCTTCCTGATGG - Intronic
1160592207 18:79951191-79951213 GGTCCCGAGACGCTCCCGGAGGG + Intronic
1160841816 19:1149779-1149801 GGCCCCGGGACCCTGCTTGGAGG + Intronic
1160988707 19:1851962-1851984 GGCCGGGGGACCCTCCGTGGAGG + Intergenic
1162566630 19:11448401-11448423 CTCCCAGGGACCCTCCCTGCAGG - Intronic
1162940410 19:14005950-14005972 GGCCCCGGCCCCCTCCCCCACGG + Intronic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1163734704 19:18972550-18972572 GGCCCCAAGACCCACGCTGAAGG - Intergenic
1165914079 19:39247419-39247441 GGCCCCGGGGACCTTCCTGGAGG + Intergenic
1165916795 19:39265513-39265535 GGCCCCGGGGACCTTCCTGGAGG - Intergenic
1166391234 19:42409952-42409974 GGCTCCAGATCCCTCCCTGAGGG + Intronic
1166689640 19:44814651-44814673 GGCCCCGGGTCACTCCCTCCAGG - Exonic
1168641435 19:58034218-58034240 GGCGCCGAGACCCTCCCGGGTGG - Intronic
925034812 2:677057-677079 GGCCCCGGCCCCCTCCCACAGGG + Intronic
925167681 2:1728325-1728347 GGCCCAGGGACCCTGCCAGCAGG - Intronic
925368283 2:3325675-3325697 GGCCTGGGGACCTTCTCTGAAGG + Intronic
926030019 2:9578279-9578301 TGGCCCGGGACCCTGGCTGATGG + Intergenic
926159221 2:10475988-10476010 CTCCCAGGGCCCCTCCCTGAAGG + Intergenic
928303500 2:30147231-30147253 AGCGCCGGGGCCCACCCTGAAGG - Intronic
928392588 2:30920832-30920854 GGCCCAGGGACCATTCCTGCTGG - Intronic
930016348 2:46973437-46973459 GGCACTGAGGCCCTCCCTGACGG - Intronic
931869096 2:66440421-66440443 GTCACCGGGTCCCTCCCGGAGGG + Intronic
933051569 2:77609360-77609382 GGCTCCGTGACACTCCCTGGTGG - Intergenic
935717498 2:105952181-105952203 GACCCAGGGATCCTCCCTGTGGG - Intergenic
935726004 2:106024564-106024586 GGCCCCAAGGCCCTGCCTGAGGG - Intergenic
936775465 2:115966861-115966883 GTCACTGGGACCTTCCCTGAGGG - Intergenic
937279821 2:120710075-120710097 GGCCCCGAGACCCTGCTTGGAGG + Intergenic
937313520 2:120916590-120916612 CGCCCCGGGGCACTCCCTGTGGG + Intronic
938169962 2:129066816-129066838 GGCCCTGGGAGCCTCCGTGGTGG + Intergenic
948307209 2:236957124-236957146 GTCCCAGGGACACTCCCTTAAGG + Intergenic
948719913 2:239893023-239893045 GGAGCCGGGACCCTCACTGGGGG + Intronic
1172567541 20:35942456-35942478 GCCACAGGGACCTTCCCTGAGGG + Intronic
1173329404 20:42062013-42062035 GGGCCAGGGCACCTCCCTGATGG - Intergenic
1174396680 20:50251055-50251077 GGCCCGGGGACCTGCCCTGGAGG + Intergenic
1175573036 20:60038522-60038544 GGCCCAGTGACCATCCCTGCTGG - Intergenic
1176362166 21:6006696-6006718 GGCTCCTGGACCCTCCCTGAGGG + Intergenic
1178749099 21:35283743-35283765 GGTCCCAGGACACTCCCAGAAGG + Intronic
1178953958 21:37006828-37006850 GCCCCGGGGACGCTCCCTGGAGG + Exonic
1179761352 21:43531849-43531871 GGCTCCTGGACCCTCCCTGAGGG - Intronic
1179879386 21:44287127-44287149 AGCCCAGGTACCCTCCCTGCAGG + Exonic
1179899302 21:44380741-44380763 GGGCCCGGGGACCTCCCTGCAGG + Intronic
1180082722 21:45494038-45494060 CTCCCCAGGACCCTCCCCGAGGG - Intronic
1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG + Intergenic
1182619960 22:31613534-31613556 GGCCCAGGGCCCCTTCCTGTGGG + Intronic
1183315514 22:37135014-37135036 GGCCCCGGGGCTCTCCCTGGAGG + Intronic
1183485299 22:38085039-38085061 GGCTCCAGGACTCTCCCTGGGGG - Exonic
1184262878 22:43329375-43329397 GCCCCTGGGACCCTCGCTGTGGG - Intronic
1184644851 22:45890119-45890141 GGCCCCAGGACCCTGCCTCTGGG - Intergenic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1185150468 22:49161116-49161138 GGCCCAGAGACCTTCCCTGCTGG + Intergenic
1185175309 22:49323017-49323039 GGCCACGGGGCCCTCCCTGTGGG + Intergenic
1185203676 22:49523927-49523949 CACCCCGGGGACCTCCCTGAAGG - Intronic
954752542 3:52821723-52821745 GACCACAGGCCCCTCCCTGAGGG - Intronic
956766289 3:72487313-72487335 GGCCCAGGGACTCACCCAGAGGG + Intergenic
958641830 3:96814756-96814778 CGCCCCGGGACACCCCCTGCGGG + Exonic
961604177 3:128081593-128081615 GGCTCCTGGACCCTCTCTGATGG - Intronic
964344714 3:155744475-155744497 GGTCCCGGGACCCCGCGTGAGGG + Intronic
966411914 3:179653406-179653428 GGCCCCGCGACCCTCCCCCGAGG - Intronic
966853083 3:184176456-184176478 GGCCCTGCGACCTTCTCTGAAGG + Intronic
966887021 3:184382479-184382501 GGCCCCCAGACCTCCCCTGAAGG - Exonic
966944483 3:184768131-184768153 GGCCTCGGGACACAGCCTGAGGG - Intergenic
968616501 4:1579814-1579836 GGCCCCTGCGCCCTCCCTGCGGG - Intergenic
968873014 4:3250972-3250994 GGCCCCGGACCCCTCCTTCAAGG - Intronic
968897730 4:3414438-3414460 GGGCCAGGGACGCTCCCTGGGGG - Intronic
969138582 4:5050698-5050720 GTTCCCAGGACGCTCCCTGAGGG - Intergenic
969220355 4:5754952-5754974 GGCCCAGGGGCTCTCCCTGGGGG + Intronic
969586603 4:8097603-8097625 GGCTCAGGGACCATCCCTGGCGG - Intronic
969720870 4:8892582-8892604 GGCCCCGGGCGCCTCCGAGAGGG - Intergenic
970320642 4:14872264-14872286 GGCTCCTGAACCCTCACTGAGGG + Intergenic
972474340 4:39436265-39436287 TCCCTCAGGACCCTCCCTGAAGG - Intronic
972941229 4:44197309-44197331 GACCCCTGGCCCCTGCCTGAGGG + Intronic
973293375 4:48490866-48490888 GGGCCCGGGCCCCTCCAGGAAGG - Exonic
982198448 4:152937470-152937492 GGCCCCGCCCCCCTCCCCGAGGG - Intronic
982746028 4:159104137-159104159 GGCCCCGGCCCGCTCCCAGAGGG + Intergenic
985558431 5:569485-569507 GGCCCCGGGGCCCTCTCTGATGG + Intergenic
985578387 5:684216-684238 GGCCCCAGGACGCTGACTGAGGG + Intronic
985885707 5:2676133-2676155 GGCTCTGGGACCCTCCCCCATGG - Intergenic
986441537 5:7786963-7786985 GACCCCATGACCCTCCCTGCTGG - Intronic
990237227 5:53781332-53781354 GGGCCTGGGGTCCTCCCTGAGGG - Intergenic
993306091 5:86277158-86277180 GGCCACGGGATGCTCCCTGGAGG + Intergenic
995048381 5:107673570-107673592 GCCCCCGAGACCCGCCCTTAAGG + Intergenic
1001906562 5:175478459-175478481 GGCCCAGGGACCCGCCCTCCGGG - Exonic
1001984232 5:176060654-176060676 GGCCCCGGGATCCGCGCTGCTGG - Intronic
1002067731 5:176660603-176660625 GGCCCAGGGACCCTCCTAGAGGG - Intergenic
1002188441 5:177466859-177466881 GGCCCCCGGGCGCACCCTGACGG - Intronic
1002233243 5:177783411-177783433 GGCCCCGGGATCCGCGCTGCTGG + Intronic
1002262735 5:178006370-178006392 GGCCCCGGGATCCGCGCTGCTGG - Intergenic
1002400957 5:178991377-178991399 GCCCCTGGGGCTCTCCCTGAGGG - Intronic
1004744735 6:18498580-18498602 GGCCCAGGGACATTCCCTAATGG + Intergenic
1006106211 6:31718537-31718559 CTCCCAGGGAACCTCCCTGAAGG + Intergenic
1006499860 6:34451212-34451234 GGACCAGGGAGCCTCCCAGAAGG - Intergenic
1006822347 6:36907426-36907448 GGCACCAGGAAGCTCCCTGATGG + Intronic
1007107922 6:39295993-39296015 GGCCCTGAGCCCCTCCCTCATGG - Intergenic
1007772366 6:44201904-44201926 GGCTCTGGGACCCTCTCTCAGGG - Intergenic
1007957270 6:45929348-45929370 GCCCCAAGGACCCTCCATGAGGG + Intronic
1017719526 6:157235208-157235230 GGGCCAGGCACCCTCCCTGGAGG + Intergenic
1017914289 6:158819397-158819419 GGTCCCGGGACCCGCCCCGCCGG - Exonic
1018368889 6:163149585-163149607 GACCCCGCGAGCCTCCCTGCAGG + Intronic
1019514997 7:1435594-1435616 GGCCCCGTCACGCTCCCAGAGGG + Intronic
1019562022 7:1664179-1664201 GCAGCCGGGACCCTCCCTGAGGG + Intergenic
1019920954 7:4163112-4163134 GGCCTCAGGAACCTCCCTGTGGG - Intronic
1019996117 7:4725474-4725496 GGCCCCGGGCCTCTGCCTGTGGG - Intronic
1023067323 7:36390405-36390427 GGCCCCGGACCCCGCCCTGCAGG - Intronic
1026000922 7:66558427-66558449 GGCACTGGGACCCTCCAGGATGG - Intergenic
1029665015 7:101989473-101989495 GGCTCCGGGACCTTCCATGGGGG - Intronic
1034179492 7:149126433-149126455 GGCCCGGGCACCCTCCGTGCGGG + Intronic
1035659334 8:1334939-1334961 GGTCCCGGGATACTGCCTGATGG - Intergenic
1036222139 8:6929777-6929799 AGCACCAGGACCCTCCCTGCAGG - Intergenic
1036224412 8:6945493-6945515 AGCACCAGGACCCTCCCTGCAGG - Intergenic
1036229023 8:6983795-6983817 AGCACCAGGACCCTCCCTGCAGG - Intergenic
1036231476 8:7002900-7002922 AGCACCAGGACCCTCCCTGCAGG - Intronic
1037902344 8:22695243-22695265 GCCCCCGGCTCCCTCCCTTAGGG + Intergenic
1038651744 8:29410102-29410124 GGCCCCGGGACCTTGTCAGAAGG + Intergenic
1039887039 8:41660681-41660703 GGCCCCGGCCCCAACCCTGACGG + Intronic
1039888438 8:41668797-41668819 GGCCACTGGTCCCTCCCTGTGGG + Intronic
1042570307 8:70156727-70156749 GACCCCGTGCCCCTCGCTGAGGG + Exonic
1047254598 8:123206222-123206244 GGCCCCAGGCCTCTCCTTGAGGG + Intronic
1049358138 8:142198820-142198842 CACCCCAGGACACTCCCTGAAGG + Intergenic
1049423802 8:142528409-142528431 GCCCCCAGGACCGTCCCTGTTGG + Intronic
1049433323 8:142575205-142575227 GGCCCCGCTGTCCTCCCTGAAGG - Intergenic
1057231668 9:93325131-93325153 GGCACCAGCACCCTCGCTGATGG + Intronic
1057463783 9:95292451-95292473 GCCCCCGGGACCCCGACTGAGGG + Intronic
1059333061 9:113548641-113548663 GGCTCCAGGACTCTCCCAGATGG - Intronic
1060530891 9:124346505-124346527 GGCCCCGGTTCCCCCCCGGAGGG - Intronic
1060544491 9:124452171-124452193 GGGACTGGGACCCTCCCTGGGGG - Intronic
1060550640 9:124483365-124483387 TGCCCAGGGATCCTCCCCGAGGG - Intronic
1061806985 9:133142179-133142201 TGCCCCTGGATCCTTCCTGAGGG - Intronic
1061820784 9:133226251-133226273 TGTCCCGGGATCCTCTCTGAAGG - Intergenic
1061872954 9:133530343-133530365 AGCAGCGGGACCCTCCCCGATGG - Intergenic
1062372098 9:136245382-136245404 GGCCCCGGGACCCGCCTTCTGGG + Intronic
1203731796 Un_GL000216v2:98543-98565 GGTCCCTGGAGCCCCCCTGACGG - Intergenic
1185619100 X:1442541-1442563 GGCCCCTGGTCAGTCCCTGAAGG - Intronic
1185757261 X:2661697-2661719 GGCCATTGGACCCTCCCTGCAGG - Intergenic
1188552032 X:31375020-31375042 GGCCCTAGGTCTCTCCCTGAGGG - Intronic
1189247225 X:39572517-39572539 GGCCCTGGGAGCCTCAGTGAAGG + Intergenic
1189268714 X:39735690-39735712 GGCCCAGCAGCCCTCCCTGAAGG + Intergenic
1189373049 X:40445327-40445349 GGCCCCTCGGCCCTGCCTGATGG + Intergenic
1189411926 X:40780110-40780132 GGCCCCAGGACTCTGCCTCATGG + Intergenic
1190440220 X:50469493-50469515 GGCGCCGGGCACCTCCCTGGAGG + Intronic
1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG + Intronic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1192430414 X:71107802-71107824 GGCCCCAGGCCCCTCCCCAAGGG + Exonic
1199991624 X:152990547-152990569 GCCCCCCGGCCTCTCCCTGATGG + Exonic
1200071967 X:153533696-153533718 GGCCCCGGGACCATGGCAGAGGG + Intronic
1200238831 X:154483145-154483167 GTCCCGAGGCCCCTCCCTGAGGG + Intergenic
1200239544 X:154486521-154486543 GGCCCGGGGACCCTACCTGCAGG + Exonic