ID: 1114630719

View in Genome Browser
Species Human (GRCh38)
Location 14:24157823-24157845
Sequence CTCACGCAGGGGTTCCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114630704_1114630719 25 Left 1114630704 14:24157775-24157797 CCTTTGCTTGCTCCTCCAATGTC 0: 1
1: 0
2: 1
3: 21
4: 223
Right 1114630719 14:24157823-24157845 CTCACGCAGGGGTTCCTGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1114630710_1114630719 -7 Left 1114630710 14:24157807-24157829 CCTCACCCTTACACCCCTCACGC 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1114630719 14:24157823-24157845 CTCACGCAGGGGTTCCTGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1114630705_1114630719 13 Left 1114630705 14:24157787-24157809 CCTCCAATGTCTCCATCTCCCCT 0: 1
1: 0
2: 1
3: 32
4: 523
Right 1114630719 14:24157823-24157845 CTCACGCAGGGGTTCCTGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1114630709_1114630719 -6 Left 1114630709 14:24157806-24157828 CCCTCACCCTTACACCCCTCACG 0: 1
1: 0
2: 1
3: 16
4: 194
Right 1114630719 14:24157823-24157845 CTCACGCAGGGGTTCCTGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1114630707_1114630719 1 Left 1114630707 14:24157799-24157821 CCATCTCCCCTCACCCTTACACC 0: 1
1: 0
2: 9
3: 114
4: 961
Right 1114630719 14:24157823-24157845 CTCACGCAGGGGTTCCTGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1114630706_1114630719 10 Left 1114630706 14:24157790-24157812 CCAATGTCTCCATCTCCCCTCAC 0: 1
1: 1
2: 1
3: 69
4: 731
Right 1114630719 14:24157823-24157845 CTCACGCAGGGGTTCCTGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1114630703_1114630719 26 Left 1114630703 14:24157774-24157796 CCCTTTGCTTGCTCCTCCAATGT 0: 1
1: 0
2: 2
3: 19
4: 216
Right 1114630719 14:24157823-24157845 CTCACGCAGGGGTTCCTGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1114630708_1114630719 -5 Left 1114630708 14:24157805-24157827 CCCCTCACCCTTACACCCCTCAC 0: 1
1: 0
2: 5
3: 42
4: 615
Right 1114630719 14:24157823-24157845 CTCACGCAGGGGTTCCTGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114630719 Original CRISPR CTCACGCAGGGGTTCCTGAG AGG Intronic
900498853 1:2989890-2989912 CTCAAGGAGGGGTTTCTTAGAGG - Intergenic
900788960 1:4666823-4666845 ATCACGGAGGGGTTGCAGAGAGG + Intronic
900788992 1:4666950-4666972 ATCACGGAGGGGTTGCAGAGAGG + Intronic
900867066 1:5276170-5276192 CTCTCCCTGGGGCTCCTGAGAGG + Intergenic
901634333 1:10663630-10663652 ACCAGGCAGGGGTCCCTGAGGGG + Intronic
901784642 1:11616757-11616779 CTCCCTCAGGGGGTCCTCAGTGG - Intergenic
904650309 1:32000674-32000696 CTCTCTCGGGGGTTCCTGATCGG - Intergenic
906493298 1:46285142-46285164 TGAAAGCAGGGGTTCCTGAGGGG - Intronic
908264070 1:62361361-62361383 CTCAGGCAGCGGCTCCTCAGGGG - Intergenic
913209321 1:116570322-116570344 CTCACGTTGGGATTCCTAAGTGG - Intronic
915143382 1:153780288-153780310 GTCACACAGGGTCTCCTGAGAGG - Intergenic
915308438 1:154994433-154994455 CTGACTCACTGGTTCCTGAGTGG + Intergenic
917498634 1:175565533-175565555 CTCACTCAGGGGATCCTGGGAGG - Intronic
919739450 1:200973316-200973338 CTCACCCAGAGGCTCCTGAGAGG + Intronic
920700158 1:208211905-208211927 CTGAGGCAGGGGCTGCTGAGGGG + Intronic
922800138 1:228361384-228361406 CCCACCCTGGGGTCCCTGAGTGG + Intronic
922997945 1:229981900-229981922 CTCAGGCAGCAGTTGCTGAGTGG + Intergenic
1066044360 10:31583010-31583032 CTCAGGCAGGAGGACCTGAGTGG - Intergenic
1068917613 10:62449342-62449364 CTCATGGAGGGGTTCCAGTGTGG + Intronic
1071603126 10:86968630-86968652 CTCAGGCAGGGGCACCTGCGTGG + Intronic
1077228850 11:1449819-1449841 CTCACCCGGGGGCTGCTGAGTGG - Exonic
1080401880 11:31943778-31943800 CTCTGGCAGGGGTTCCTTGGAGG - Intronic
1085319806 11:75567006-75567028 CTCTTGCAGGGGGTCCTGGGAGG - Intronic
1087127008 11:94638332-94638354 CTCAGGCAGTTGTTCCTAAGAGG + Intergenic
1089079890 11:115766739-115766761 CTGACTCAGGGGGTCCTCAGAGG + Intergenic
1094292938 12:28872569-28872591 TTCATGTAGGGGTTCCTGGGTGG + Intergenic
1096504911 12:52086665-52086687 CTCAAGGAGGGATTCCAGAGAGG - Intergenic
1101437064 12:104672833-104672855 CTCACGCCTGGGTGTCTGAGTGG - Intronic
1102045033 12:109824398-109824420 CTCAAGCAGGGCTGGCTGAGAGG - Intronic
1102229862 12:111255192-111255214 GTCACCCAGGGGTCCCAGAGAGG - Intronic
1110146868 13:72202631-72202653 CTCACACAGGGGTTTCTCAGGGG + Intergenic
1114630719 14:24157823-24157845 CTCACGCAGGGGTTCCTGAGAGG + Intronic
1121523135 14:94599872-94599894 CCCACGCTGGGGGCCCTGAGGGG + Intronic
1123112710 14:105880673-105880695 CTCACTCAGGGCCTGCTGAGGGG - Intergenic
1126434813 15:48625507-48625529 CTCATGCAGGGGGTCCAGAAGGG - Intronic
1127401990 15:58597589-58597611 CTGACGCTGGGGTTGCTGAATGG + Exonic
1132010311 15:98269034-98269056 CTGACACATGGGGTCCTGAGCGG - Intergenic
1132392207 15:101447280-101447302 CTCACGCAGGGTCACCTGTGGGG + Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1133298362 16:4766804-4766826 CCCACGCGGGGGTGCCTGACGGG - Intronic
1139223005 16:65203927-65203949 CTCATGCAGCACTTCCTGAGAGG - Intergenic
1139656248 16:68388728-68388750 TTTAGGGAGGGGTTCCTGAGGGG + Intronic
1142523373 17:520307-520329 CTCACGCAGGGTTTCCCGGATGG - Intronic
1146677148 17:34781480-34781502 CTGCTGCAGGGGTCCCTGAGGGG - Intergenic
1147427333 17:40352133-40352155 CACAAGAAGGGGTGCCTGAGAGG - Intronic
1148680397 17:49470344-49470366 CTCACGCAGCCTTTCCTGGGCGG - Intronic
1151715418 17:75828715-75828737 CTCAGGCAGGGGCCCCAGAGAGG - Intronic
1157611580 18:48959978-48960000 CTCACGGTGGGGTTGCTGGGAGG + Intergenic
1158452582 18:57580483-57580505 CTCGTGCAGGGGTTCTTGTGAGG - Intronic
1158903903 18:61992397-61992419 TTCACCCAAGGGTTTCTGAGGGG + Intergenic
1160923482 19:1531738-1531760 CTCTCCCAGGGGGTCCTGTGTGG - Exonic
1161041215 19:2111631-2111653 CCCACGCCGGGGTTCCTGGCGGG - Intronic
1166067643 19:40369567-40369589 CTCAGGCAGGGGGTCCTGGAAGG - Intronic
924974657 2:161515-161537 CTCACGCAGTGCTTCAGGAGAGG + Intergenic
928336332 2:30401599-30401621 TTCAGGCAGGTGTTTCTGAGTGG - Intergenic
930531624 2:52595709-52595731 CTTACGATGGGGTTACTGAGTGG + Intergenic
937275275 2:120680034-120680056 CACACGCAGGTGTGCCAGAGGGG - Intergenic
939695346 2:145316521-145316543 CTCACCCAGGGATTCCAGACTGG - Intergenic
939877638 2:147595892-147595914 CCCAGGCAGGGGTACCTGGGGGG - Intergenic
943834916 2:192506895-192506917 CTAAGGCAGGCGTCCCTGAGTGG - Intergenic
946154408 2:217797722-217797744 CTCACGCACGTGCACCTGAGAGG - Intergenic
947716698 2:232343424-232343446 CTCAGGCAGGCGTTCCTCTGTGG - Intronic
1171238635 20:23547760-23547782 CTCAGGCGGGCATTCCTGAGTGG - Intergenic
1172271855 20:33659524-33659546 TTCACGCAGGGGTTCCAGCCGGG + Exonic
1174336825 20:49868375-49868397 GTCACGCAGGGTTTTCAGAGAGG + Intronic
1174798741 20:53544593-53544615 CTCCAGCAGTGGTTCTTGAGTGG - Intergenic
1175260792 20:57672937-57672959 CCCACGCACGGGTTGCTGTGTGG + Intronic
1175751593 20:61501910-61501932 CTCACTCAGGCATTCCTCAGAGG - Intronic
1175960970 20:62636233-62636255 CTCTCCCAGGGGTGCCTCAGTGG + Intergenic
1178923989 21:36760237-36760259 CTCAAGCATGGGTTCCTGAAGGG - Intronic
1179959990 21:44762750-44762772 CTCCCACAGGGGCTGCTGAGAGG - Intergenic
1183222606 22:36526061-36526083 CTCAGGCTGGGGTCCCTGTGCGG - Exonic
1184669712 22:46006376-46006398 CTCACCCAGGGCTCCCAGAGAGG + Intergenic
1185383601 22:50521631-50521653 CCCAGCCAGGGGTACCTGAGTGG - Intronic
950958198 3:17077761-17077783 CTCACACAAGGGATCATGAGAGG + Intronic
953385835 3:42505188-42505210 CTGGGGCAGGGGTTGCTGAGAGG + Intronic
957851510 3:85813610-85813632 CTCACGCAGTGTGTCCTGAATGG + Intronic
966971806 3:185051337-185051359 CAAACTCAGGGGTTCCAGAGTGG - Intronic
974025448 4:56729486-56729508 CTCACTCAGTGGTTCCTCAGGGG + Intergenic
981653554 4:147086653-147086675 CTAACACAGAAGTTCCTGAGTGG + Intergenic
983986661 4:174067793-174067815 CCAGCGCAGGGGTTCCTGAGAGG + Intergenic
985913582 5:2901262-2901284 CCCACGCAGGAGGGCCTGAGGGG - Intergenic
991643464 5:68777145-68777167 GTGCCCCAGGGGTTCCTGAGAGG - Intergenic
995516464 5:112959315-112959337 CTTATGCAGGCTTTCCTGAGTGG + Intergenic
997477299 5:134151341-134151363 CTCAAGCAGGGTTTCCAGAGTGG - Exonic
1002066055 5:176652270-176652292 CTCCAGCAGGAGTTCCTGGGAGG - Intronic
1003124055 6:3341126-3341148 CTCACACAGAGGTTGCTGAGAGG + Intronic
1004870094 6:19895718-19895740 GCCATGCAGGGGCTCCTGAGTGG + Intergenic
1009289744 6:61868138-61868160 CTCAAGCAGGGGTGGCTGGGAGG + Intronic
1010214341 6:73388579-73388601 TGCACCCATGGGTTCCTGAGAGG + Intronic
1011659167 6:89579385-89579407 ATCAGGCAGGGAGTCCTGAGTGG + Intronic
1014779128 6:125543126-125543148 ATCATGCAGGTTTTCCTGAGTGG - Intergenic
1019413429 7:916661-916683 CACACACAGGGATTCTTGAGAGG + Intronic
1021183056 7:17531270-17531292 TCCACACAGGGGTTCCTGACTGG - Intergenic
1032121824 7:129162334-129162356 CCCATCCAGGGGTTCCTCAGTGG + Intronic
1033645894 7:143303824-143303846 CGCACCCAGGGGATCCTGCGTGG - Exonic
1035120296 7:156561028-156561050 CTCACACACTGCTTCCTGAGAGG - Intergenic
1035474936 7:159136654-159136676 TTGACGCGGGGGTTCTTGAGAGG - Intronic
1036617299 8:10398464-10398486 CTCCTGCAGGGGTCCCTCAGAGG + Intronic
1045362127 8:101442468-101442490 TTCACTCACGTGTTCCTGAGAGG + Intergenic
1056234866 9:84584801-84584823 CTCAGGCAGTGGTTCCCTAGGGG - Intergenic
1060858294 9:126933367-126933389 TTCGGGCAGGGGTTACTGAGTGG + Intronic
1061505793 9:131031197-131031219 CTAAAGCAGGGGCTCCTGGGCGG + Intronic
1061870993 9:133520460-133520482 CTCCCGCAGAGGGTCCTGTGGGG + Intronic
1062524633 9:136973287-136973309 CTCACTCTGGGGTTCCTTTGAGG - Intergenic
1202113129 Y:21445302-21445324 GTCACACAGGGGATCCTGAATGG + Intergenic