ID: 1114631764

View in Genome Browser
Species Human (GRCh38)
Location 14:24163866-24163888
Sequence CTGTGTCCGCAGGAGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 509}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114631764 Original CRISPR CTGTGTCCGCAGGAGGAGGA GGG Exonic
900031826 1:378170-378192 CAGCCTCCGCAGGAGGAGGTGGG + Intergenic
900052374 1:606361-606383 CAGCCTCCGCAGGAGGAGGTGGG + Intergenic
900206373 1:1433537-1433559 CTGTGCCTGCAGGAGGCAGAGGG + Intergenic
900358235 1:2274995-2275017 GTGTGTCAGCAGGTGGAGGCTGG + Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900391282 1:2435061-2435083 CTTTGTCAGCAGCAGGAGGCAGG + Intronic
900595865 1:3479892-3479914 CTGGTTCTGCAGCAGGAGGATGG + Exonic
901142003 1:7041048-7041070 GTGTGGGCGCAGGAGGCGGAGGG + Intronic
901229666 1:7634683-7634705 CTGGGGCTGCCGGAGGAGGAAGG + Intronic
901349186 1:8577576-8577598 CTGTGTCAGCATGATGAGTATGG - Intronic
901558766 1:10052939-10052961 CTGTGTCCTCACTTGGAGGAAGG + Intronic
901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG + Intronic
901948215 1:12720801-12720823 CTGTGTCTGTAGGAAGAAGACGG + Intronic
902190840 1:14762087-14762109 CTGTGTCCTCAGGATGACGGTGG + Intronic
903259293 1:22122658-22122680 CTGTGTCCGCAGGAGCGGAGGGG + Intronic
903266796 1:22162712-22162734 CAGTGTCCGCAGGAAGGGGATGG + Intergenic
903266877 1:22163047-22163069 CAGTGTCCCCAGGAAGGGGATGG + Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903787328 1:25870113-25870135 CTGAGCCAGCAGGATGAGGATGG + Intronic
903999999 1:27333546-27333568 CTGTGTCCCCACGTGGTGGAGGG + Intronic
904453091 1:30629096-30629118 CTGTGTTCTCAGGAGCAGGAAGG - Intergenic
904871601 1:33622508-33622530 ATGTGCCCGCAGGAGGGTGAGGG + Intronic
905340694 1:37275383-37275405 CTGTGGCTGCAGGGAGAGGATGG - Intergenic
906341652 1:44986337-44986359 CTGTGTCCGAAGTAGAAGGGAGG - Intronic
907238804 1:53069443-53069465 CTGTGGCTGCTGGAGGAGGCAGG + Intronic
907291152 1:53413832-53413854 CTGTGTGCTCAGGAGGTGGGAGG - Intergenic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907586576 1:55623239-55623261 CTGTGTCCTCATGTGGTGGAAGG + Intergenic
907709468 1:56865397-56865419 CTGTGTCCTCACGTGGTGGAAGG + Intronic
909736005 1:78962494-78962516 CTGGGTCGGCAGGAGGAAGGGGG - Intronic
912474806 1:109928615-109928637 CTGATTCCCCAGGAGGAGGTAGG + Intronic
912510375 1:110185655-110185677 ATGTGACTGCAAGAGGAGGATGG - Intronic
913050018 1:115109460-115109482 CTGTGTCCAAATGTGGAGGAAGG + Intergenic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
914379357 1:147102670-147102692 CTGCGTCCTCAGGAGGAGGGAGG - Intergenic
917276124 1:173333616-173333638 CTGTGTCCTCAGGAGTTGGAGGG - Intergenic
917670745 1:177270996-177271018 CTGTGTCCACATGTGGAGGGAGG + Intronic
918077796 1:181183538-181183560 CTGTGTCCTAAGAAGGAGGATGG + Intergenic
918251949 1:182710686-182710708 CTGTTACCACAAGAGGAGGAGGG + Intergenic
918313033 1:183300084-183300106 ATGTGTCCTCACAAGGAGGAAGG - Intronic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
920178709 1:204119407-204119429 CTGTGTCCTCAGGTGGTGAAAGG + Intronic
920263284 1:204704045-204704067 CGGTGGCCACAGGAGGAGGCTGG + Intergenic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
920744211 1:208610765-208610787 CTGTGTCCTCATGTGGAAGAAGG + Intergenic
921144487 1:212340193-212340215 CTGGATCCTCAGGAAGAGGATGG - Intronic
921322291 1:213953723-213953745 CTGTGTGGGCAGGTGGAGGCTGG - Intergenic
921380907 1:214523742-214523764 CAGCCACCGCAGGAGGAGGAGGG - Intronic
922790072 1:228306401-228306423 CAGAGTCTGCAGGCGGAGGAGGG + Exonic
923015144 1:230120732-230120754 GTGTGTGCGGAGGAGGATGAGGG - Intronic
923492827 1:234499409-234499431 ATGTGTCCCCAGGAGGGGAAGGG - Intergenic
923948048 1:238912757-238912779 CTGTGTCCTCAAGTGGTGGAAGG + Intergenic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1062981205 10:1724520-1724542 TTGTGTGCGCAGCAGCAGGAGGG + Intronic
1063046182 10:2394435-2394457 CAGAATCCGCTGGAGGAGGAAGG + Intergenic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063539126 10:6914349-6914371 CTGTGTCCACTGGAGGAGCTCGG - Intergenic
1063762250 10:9093087-9093109 CTGTGTCCTCACCTGGAGGAAGG - Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1065261061 10:23923602-23923624 ATGTGTCGGAAGAAGGAGGAAGG + Intronic
1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG + Intergenic
1066251592 10:33638050-33638072 CTGTGTCCTCAAGTGGTGGAAGG - Intergenic
1066650693 10:37652162-37652184 GTGTGTGCGCTGGAGAAGGAAGG - Intergenic
1067095020 10:43294538-43294560 GTGTGTCCACAGGAGGAGCTGGG - Intergenic
1068510387 10:57958224-57958246 CTGTGTCCTCAAAAGGTGGAAGG - Intergenic
1070517982 10:77225707-77225729 CTGTGGCCCCAGGAGGAGACAGG + Intronic
1070674326 10:78401905-78401927 CTGTGTCCCCAGGACCGGGATGG + Intergenic
1070718261 10:78738451-78738473 CTGTTTCCCCAGGAGGTGAAGGG - Intergenic
1070766714 10:79061006-79061028 CTGTGTCCACAGGAGGAAGGGGG + Intergenic
1070778656 10:79125026-79125048 CTGTGGCAGCAGGAAGAGCAAGG + Intronic
1072271038 10:93776856-93776878 CTGTGTGCAAAGGAGGAGGTTGG + Intronic
1072414115 10:95232586-95232608 CTGTGTCCCCAAGAGGTAGACGG - Intergenic
1072619558 10:97070660-97070682 CTGTGTCCTCACACGGAGGAAGG - Intronic
1072716374 10:97755494-97755516 CTGTGTCCTCATGAGAAGGTGGG + Intronic
1072764411 10:98083992-98084014 CTGTCTCTTCAGGAGGTGGAAGG + Intergenic
1073983214 10:109178309-109178331 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1075098599 10:119490117-119490139 TTGTGTCCGAAGGAAGGGGAAGG - Intergenic
1075265801 10:120998997-120999019 CTGGGCCTGCAGGAGGAGCAAGG + Intergenic
1075359416 10:121816576-121816598 CTGTGTCCTCATGTGGTGGAAGG - Intronic
1076063568 10:127431062-127431084 CTGTGTGCTCAGGAGGAAGCTGG + Intronic
1077308048 11:1876621-1876643 AAGTGTCTGCAGGGGGAGGACGG + Intronic
1077548902 11:3190727-3190749 CTGTGTCCTCACGGGGTGGAAGG + Intergenic
1078735415 11:14015344-14015366 CTGTGTCCTCAGGTGGTAGAAGG + Intronic
1078928531 11:15895447-15895469 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1079384284 11:19965156-19965178 CTGTGTCCTCAACAGGAGAATGG - Intronic
1080654233 11:34245965-34245987 TTGTGGCCCCAGGATGAGGAGGG - Intronic
1080867518 11:36208446-36208468 CTGTGTCCCCAGGTGGCCGAAGG + Intronic
1081163517 11:39781871-39781893 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1082772261 11:57217205-57217227 CTGCTTCCCCAGGAGGAGGAAGG - Intergenic
1083489962 11:63008988-63009010 TTATGTGCGCAGGAGGAGGTGGG - Intronic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1084084381 11:66848246-66848268 CTGTGTCCATAAGAGGATGAAGG + Intronic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084621042 11:70270578-70270600 CTGTCTCCTCAGGAGGGGGCGGG - Intergenic
1084736858 11:71110977-71110999 CTGTGTCTTCACGTGGAGGAAGG - Intronic
1084953584 11:72679773-72679795 CTGTCTCAGTTGGAGGAGGAAGG - Intergenic
1085475038 11:76784028-76784050 CTGGGACCTCAGGAGGGGGAGGG - Intronic
1085509499 11:77081027-77081049 CCCTGGCCACAGGAGGAGGAGGG + Intronic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1089167507 11:116488442-116488464 TTGTGACCTGAGGAGGAGGAGGG + Intergenic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1090788076 11:130068134-130068156 CTGTGTTCGCACATGGAGGAGGG + Intergenic
1090901247 11:131033565-131033587 CTGAGTCAGCAGGGGAAGGATGG + Intergenic
1090914603 11:131152197-131152219 CTGAGTCCGCAGCAGGCGAAAGG + Intergenic
1090952330 11:131484624-131484646 GTGTCTACGCAGGAGGAAGAGGG - Intronic
1091053152 11:132393079-132393101 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091553348 12:1553630-1553652 CTGTGGCCCCAGGAGGAAGCTGG + Intronic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1091800955 12:3324151-3324173 CTGGGACCACAGGAGGAGGGAGG + Intergenic
1092163440 12:6328526-6328548 CTGTGTCCGGAGGCTGAGGCGGG + Intergenic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1097680868 12:62647768-62647790 CTGTGTGGGCTGGAGGAGGTGGG + Exonic
1097996082 12:65888990-65889012 CTGTGTCCACACTAGGAGGAAGG + Intronic
1098527201 12:71499723-71499745 CTGTTACCCCAGGAGGAAGAGGG + Intronic
1098877112 12:75877348-75877370 CTGTGTCTGCCAGAGAAGGAGGG + Intergenic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1100335377 12:93624157-93624179 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1100841166 12:98612851-98612873 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1101400714 12:104384333-104384355 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1101518018 12:105454983-105455005 CTGTGTCCTCACGTGGAAGAAGG - Intergenic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1101954568 12:109201802-109201824 CTCTGTCTGCAGGTGGAGGCAGG - Intronic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1102487876 12:113270418-113270440 CTGTGTCCTCACGTGGTGGAAGG + Intronic
1102812907 12:115839789-115839811 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1104110784 12:125702262-125702284 CTGTGTCCCCACCAGGTGGAGGG + Intergenic
1104805719 12:131588065-131588087 CTGTGTCCTCCCGAGGAGGAAGG - Intergenic
1104903049 12:132199364-132199386 AGGTGCCCGCGGGAGGAGGAGGG + Intronic
1104947543 12:132423354-132423376 CGGGGTTCGCAGGAGCAGGAGGG - Intergenic
1105578911 13:21675576-21675598 CTGCTGCCGGAGGAGGAGGAGGG - Intronic
1105707977 13:22980596-22980618 CTGTGTCTCCTGGAGGAGGCTGG + Intergenic
1106933478 13:34692535-34692557 CTGTGTCCTCACAAGGAGGCAGG + Intergenic
1107300799 13:38963881-38963903 CTGTGTCCTCAGTTGGTGGAAGG - Intergenic
1107623060 13:42253311-42253333 CTGTGTCCGCACATGGTGGAAGG - Intronic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1108521632 13:51251680-51251702 CTGTTCCTGCAGGAGGAGTACGG + Exonic
1109232998 13:59781912-59781934 CTGTGTCCTCATGTGGTGGAAGG - Intronic
1110899313 13:80800617-80800639 CTCTGTCACCAGGATGAGGATGG + Intergenic
1111240528 13:85467466-85467488 CTGTGTCCTTACGTGGAGGAAGG - Intergenic
1111256108 13:85670674-85670696 CTGTGTCCCTGGGAAGAGGATGG + Intergenic
1111555206 13:89871836-89871858 CTTTGTCACCAGGACGAGGATGG - Intergenic
1112025202 13:95405364-95405386 CTGTGTCTTCTGGTGGAGGAGGG + Intergenic
1112917320 13:104567405-104567427 ATGTGTACGAAGGAGGAGAAAGG + Intergenic
1113521710 13:110946379-110946401 ATGTGTCCGGGGCAGGAGGACGG + Intergenic
1113756523 13:112815448-112815470 GTGTGTCTGAAGGATGAGGAAGG - Intronic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114661001 14:24344816-24344838 CTGAGTCGGCAGGGGGTGGAAGG - Intergenic
1115913540 14:38283640-38283662 CTGTGTCCTCAGGTGGTGGAAGG - Intergenic
1116250685 14:42479219-42479241 CTGTGTCCACACGTGGTGGAAGG - Intergenic
1116948516 14:50857801-50857823 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
1117805294 14:59484380-59484402 CTGACTCCGCGGGAGGAGGGCGG + Exonic
1119539579 14:75429107-75429129 CTGGGTCAGTAGGAGGAGCAGGG + Intronic
1121526251 14:94621450-94621472 CTGAGTCCCCTGAAGGAGGAAGG - Intronic
1121867924 14:97379868-97379890 CAGTGTCTGCAGGACAAGGAAGG - Intergenic
1122138454 14:99647862-99647884 CTGTGTCCTCTGGAGGAGAGAGG + Intronic
1122364309 14:101185427-101185449 CAGAGTCTGCAAGAGGAGGAAGG + Intergenic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1122863104 14:104591377-104591399 CTGTGTCCCCAGCAGAAGGTGGG - Intronic
1122964792 14:105117743-105117765 CTGTGACAGCAGGAAGAGCAGGG + Intergenic
1123016501 14:105378049-105378071 CTGGTTCCGAAGGTGGAGGAGGG - Intronic
1123017503 14:105382372-105382394 CTGTGGCTGCAGGGGGAGCAGGG + Intronic
1124093736 15:26629494-26629516 ATGTGTTGGCAGGAGGAGGAGGG + Intronic
1126964029 15:54030786-54030808 CTGTGTCCTCAGGTGGCAGAAGG + Intronic
1127964265 15:63912107-63912129 GTATGTCCGCAGGCGGTGGAAGG - Exonic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1129144329 15:73633355-73633377 CTGCGGCGGCAGGAGGAGGACGG - Exonic
1129424449 15:75454058-75454080 CTCTCTCCGCCGGAGGAGGCCGG + Intronic
1129795603 15:78374014-78374036 CTGTGTCAACATGAGGAGGGAGG - Intergenic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1131933100 15:97467975-97467997 ATGTATCTGCAGGAGGGGGATGG + Intergenic
1131960393 15:97784471-97784493 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
1132366913 15:101264475-101264497 CTGTTTCTGCAGGAGGAAGCAGG - Intergenic
1132841780 16:1981522-1981544 CTCTGGCCACAGGAGGAGGGAGG + Exonic
1133305214 16:4804179-4804201 CTGTCTCCACGGGAGGAAGAGGG + Exonic
1133813331 16:9177915-9177937 CTGTGTCCTCTTGAGGTGGAAGG + Intergenic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1135845327 16:25913378-25913400 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1141466906 16:84212271-84212293 CTGTGTCAACAGGGCGAGGAAGG - Intergenic
1141813401 16:86391973-86391995 CAGTGTCTGCTGGAGGAGGCAGG - Intergenic
1141883869 16:86878693-86878715 CTGTGTCCCAAGCAGGAGGCAGG - Intergenic
1142107785 16:88315602-88315624 CTGTGACCCCAGAAGGAGGGTGG + Intergenic
1143543317 17:7582260-7582282 CAGTGGCCCCAAGAGGAGGAAGG - Intergenic
1144263950 17:13550282-13550304 CTGTGTTCTCAGGAAGAAGAGGG - Intronic
1144523282 17:15968568-15968590 CTGTGTGGTCAGGCGGAGGAGGG + Intronic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144825636 17:18104202-18104224 GTGTGTGCGCACCAGGAGGATGG - Intronic
1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1145898360 17:28473946-28473968 CTCAGTCCTCAGGAGGAGCAGGG - Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146592268 17:34137787-34137809 CTGTGTCCTCATGTGGTGGAAGG + Intronic
1146661165 17:34666003-34666025 CGGGGACCGCAGGAGGAGGTGGG + Intergenic
1146936008 17:36813136-36813158 CGGTGTCGGCAGGAGCAGGTGGG - Intergenic
1147182635 17:38696195-38696217 CTGTGTGCCCTGGTGGAGGAGGG - Intergenic
1147479149 17:40742434-40742456 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
1148053165 17:44779205-44779227 ATGTTTCTGCAGGGGGAGGATGG - Exonic
1148806713 17:50267473-50267495 CTGGGGCCGGAGGAGGAAGAGGG + Intergenic
1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG + Intronic
1149707466 17:58707880-58707902 CTGTGTCCTCATGGGGAGGAAGG + Intronic
1149849978 17:60028483-60028505 CTCTGTCCACAGAAGGGGGAGGG - Intergenic
1149852758 17:60050206-60050228 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1149860189 17:60118041-60118063 CTCTGTCCACAGAAGGGGGAGGG + Intergenic
1151342565 17:73481247-73481269 CTGTGTCCCTCGGAGGAGGGGGG + Intronic
1151630500 17:75307890-75307912 CTGTGCCCGCAGGAGGATGGAGG + Intergenic
1152067404 17:78119202-78119224 CTGTGGCCCCAGGGGGAGGCAGG + Intronic
1152100208 17:78297013-78297035 CTGTGTCCTCATGTGGCGGAAGG - Intergenic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1152387686 17:79984902-79984924 CTGTGTCCGAAGCTGGAGGATGG - Intronic
1152477051 17:80525403-80525425 CTGTGTCCTCACGTGGTGGAGGG - Intergenic
1152703590 17:81831926-81831948 TTGGGTCCCCTGGAGGAGGAAGG - Intronic
1152890810 17:82880734-82880756 GTCTGTCCACAGGAGCAGGAGGG + Intronic
1152918682 17:83054770-83054792 ATGTGTCCTCACGTGGAGGAAGG - Intergenic
1152947831 17:83207544-83207566 CAGCCTCCGCAGGAGGAGGTGGG - Intergenic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1156241339 18:35257493-35257515 CTGTGTCCTCACGTGGTGGAAGG - Intronic
1156388377 18:36626916-36626938 CTGTTATCCCAGGAGGAGGAGGG + Intronic
1156465546 18:37346131-37346153 CTATGTCTGCTGGAGGATGAGGG + Intronic
1156541317 18:37913738-37913760 CTGTGGCTGAAGGAGGTGGATGG - Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157776934 18:50403202-50403224 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1158548204 18:58413770-58413792 CTGTGGCTGCAGGTGGAGGGAGG - Intergenic
1159001935 18:62982081-62982103 CTGTGTCTGCTGCAGGAGAAAGG + Intergenic
1159040172 18:63317921-63317943 CTTTGTCCAGAGGAGGAGGTAGG + Intronic
1159410218 18:68064504-68064526 CTGTGTCCTCACGTGGCGGAAGG + Intergenic
1159564260 18:70031359-70031381 ATGTGTCCCCAGAAGGAGAAAGG - Intronic
1160556875 18:79731133-79731155 ATGTGTCCCCAGGATGAAGAGGG - Intronic
1160609907 18:80076884-80076906 CTGTGTCCTCACGTGGTGGAAGG + Intronic
1160687879 19:445326-445348 CTGTGTCCTCACGTGGTGGAGGG - Intronic
1160711901 19:555976-555998 CTGTGACCTCTGGAGGAGGCTGG - Intergenic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1161435255 19:4259021-4259043 CTGTGTCCTCAGAAGGCGGCTGG - Intronic
1161592007 19:5133131-5133153 CTGTGTCCACAGGAGATGCAGGG + Intronic
1161730787 19:5959358-5959380 CTGCGTCTGCAGGAGTGGGATGG - Intronic
1161771712 19:6234309-6234331 CCCTGTCCGGAGGTGGAGGAGGG + Intronic
1161772584 19:6239125-6239147 CTGTGTCCAGAGGAGGGGCAGGG - Intronic
1162066580 19:8129407-8129429 GTGTGTCCGAGGCAGGAGGAGGG + Intronic
1162476688 19:10904715-10904737 CTGTGTCCTCAGGATGATCAGGG - Intronic
1163834264 19:19563554-19563576 CAGAGTCCGCAGGGTGAGGAAGG + Exonic
1164616132 19:29667713-29667735 CTGTGTCCGGAGTAGGAGAGAGG + Intronic
1164630013 19:29755913-29755935 ATGTGTCCTCAGCAGCAGGAGGG - Intergenic
1165042808 19:33081075-33081097 CTGGGTCCGCGGGCGGGGGAAGG - Exonic
1165272772 19:34724775-34724797 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1165520730 19:36311925-36311947 CTGTGTCCCCTAGAGTAGGAGGG + Intergenic
1165623342 19:37266660-37266682 CTGTGTCCCCTAGAGTAGGAGGG - Intergenic
1165901800 19:39172736-39172758 CTGTGTCCCCAGGGAGGGGAGGG + Intronic
1166209170 19:41294704-41294726 TTGTGTCCTCAGGAGAAGGGAGG + Intronic
1166545805 19:43634523-43634545 CTGACTCCTCAGGAGGGGGAGGG - Intronic
1166907819 19:46125578-46125600 CTGTGCCAGCAAGTGGAGGATGG - Intergenic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1167386839 19:49168468-49168490 CTGGGTCTGAGGGAGGAGGAGGG + Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167741036 19:51325232-51325254 CTGGGTCTGAGGGAGGAGGAGGG + Intronic
1167752122 19:51387615-51387637 CTGGGTCTGAGGGAGGAGGATGG + Intronic
1168077687 19:53990392-53990414 CTGGGTCTGAGGGAGGAGGAGGG - Intergenic
1168104907 19:54160714-54160736 CTGGGTCCGAAGGAGGAGGTGGG - Intronic
1168155763 19:54472511-54472533 CTGGGTCTGAGGGAGGAGGAAGG - Intronic
1168325667 19:55537321-55537343 CTGAGTCTGAGGGAGGAGGAGGG - Intergenic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
924980815 2:219454-219476 CTGTGTCCTCACAAGGAGGAAGG - Intronic
925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG + Intergenic
925018979 2:553711-553733 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925018993 2:553742-553764 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925019004 2:553772-553794 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925675895 2:6360679-6360701 CTGTGTCTGCAGGAGGAGATCGG + Intergenic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
926911656 2:17857347-17857369 CTCTTTCCCCAGGAGAAGGAGGG + Intergenic
927136413 2:20099895-20099917 CTGTGTGCGCAGGAGAAGGGAGG + Intergenic
927248593 2:20978353-20978375 CTGTTTCTGCAGGAGAATGAGGG - Intergenic
927758176 2:25725483-25725505 CAGTGGTCTCAGGAGGAGGAAGG - Intergenic
927862000 2:26565887-26565909 CTGTGTCCCCAGGAACAGCATGG - Intronic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929533847 2:42768291-42768313 GTCTGGCCTCAGGAGGAGGAGGG + Intronic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930978057 2:57488647-57488669 CTGTTTCCTCAAGTGGAGGAAGG - Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
932777957 2:74539735-74539757 CTGCGGCCCCAGGAGGTGGATGG - Intronic
933718004 2:85376343-85376365 CTGTGCCAGCAGGGGAAGGAGGG + Intronic
933980946 2:87550286-87550308 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
935175386 2:100644199-100644221 TTGTGTCTGCGGGAGGAGGAAGG + Intergenic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
936312884 2:111400499-111400521 CTGTGTCCTCACAAGGTGGAAGG - Intergenic
936450949 2:112633704-112633726 CTGTGTCCTCAGATGAAGGAAGG - Intergenic
937094086 2:119224392-119224414 CTTGGTCCCCAGGAGGAGGCTGG + Intronic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
940378569 2:152986963-152986985 CTGTGTCCAAAGGTGGTGGAGGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942278944 2:174342258-174342280 GGGTGTCCGCCGGAGGACGAAGG - Intergenic
945044617 2:205770865-205770887 CTGTGTCCCCTGGGGAAGGATGG - Intronic
946420341 2:219561222-219561244 CTGTGGCCGCAGTAGGATGGGGG + Intronic
947352566 2:229261659-229261681 CTGTGTCCATGGGAGCAGGAGGG - Intronic
948364669 2:237446950-237446972 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
948468980 2:238165439-238165461 CCGAGTCCCCAAGAGGAGGAAGG - Intronic
948554394 2:238797434-238797456 TGGGGTCCACAGGAGGAGGACGG + Intergenic
948789514 2:240370086-240370108 CTGTGTCTGGGGGAGGAGGGTGG + Intergenic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1169926205 20:10787198-10787220 TGGTGGCCGAAGGAGGAGGAAGG + Intergenic
1172206332 20:33165432-33165454 TTCTGTCCACAGGAGAAGGAAGG + Intronic
1174184307 20:48694866-48694888 CTGTGTCTGCCGGTGGAGAAGGG + Intronic
1174220863 20:48954111-48954133 CAGTGTCCACAGGAGGACAAGGG + Intronic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175394096 20:58646911-58646933 CTGTGGCTGCAGGATGAGGAGGG + Intergenic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1175515668 20:59568384-59568406 CTCTGTGCCCAGGTGGAGGAGGG + Intergenic
1175680985 20:60988715-60988737 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1175709110 20:61205169-61205191 CTGTTTCATCAGGAGGATGAGGG + Intergenic
1175992821 20:62797853-62797875 CTGTGGCAGCAGGAGGTGGTGGG + Intronic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1178151940 21:29805140-29805162 CTGTGGCTGCAGGGGGTGGAGGG - Intronic
1178291206 21:31370023-31370045 CTGTGTCCTCATGTGGTGGAAGG - Intronic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179931673 21:44574905-44574927 CTGGGTTGGCAGGAGGAGGTGGG - Exonic
1180100287 21:45580789-45580811 CTGTGACCGCAGGATGAGAAGGG + Intergenic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180922053 22:19526047-19526069 ATGGGTCTGCAGCAGGAGGAAGG - Intronic
1181035875 22:20169535-20169557 CAGTGACCACAGGACGAGGAGGG - Intergenic
1181949939 22:26546537-26546559 CTGTGTTCCCTGGAGGGGGATGG - Intronic
1182497303 22:30718646-30718668 CTGTGGCCCCAGGGGCAGGAAGG - Intronic
1182831693 22:33309505-33309527 CTGTGTCCTCACGTGGTGGAAGG - Intronic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1184832151 22:46995743-46995765 CAGAATCCGCAGGTGGAGGAAGG - Intronic
1184956368 22:47889461-47889483 CTGTGTCCTCATGTGGTGGAAGG + Intergenic
1185152804 22:49175634-49175656 CTGTGTCCTCATGAGGTGAAAGG - Intergenic
1185387768 22:50544194-50544216 CTGTGGCCGCAGTTGGAGGATGG - Intergenic
949908223 3:8877341-8877363 CTGTGTCCTCATGTGGCGGAAGG + Exonic
950235818 3:11319440-11319462 CTGTGTCCTCATGTGTAGGATGG + Intronic
950406296 3:12807213-12807235 GTGTGGCCGCAGGAGCATGAGGG + Intronic
950906531 3:16544089-16544111 CTGCTTCCCCAGGAGGAGGCTGG - Intergenic
950963827 3:17132196-17132218 CAGTGTCAGCAGGAAGCGGAGGG - Intergenic
951008479 3:17647633-17647655 CTGTGACTGCAGTAGGGGGAAGG + Intronic
951021580 3:17786677-17786699 CTGAGTCCTCATGTGGAGGAAGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951389075 3:22080835-22080857 CTGTGTCCTCACGTGGAGCAAGG - Intronic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
954385398 3:50241348-50241370 CTTTGTCTGCAGGAGCAGGCAGG + Intronic
954801702 3:53190736-53190758 CTGTGTGCCCTGGTGGAGGAGGG - Intronic
954876245 3:53804875-53804897 CTGTGTCCAAGGGAGGAGGCGGG + Intronic
954968364 3:54630484-54630506 GTGAGTCTGCAAGAGGAGGATGG - Intronic
956041561 3:65150397-65150419 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
958662477 3:97088561-97088583 CTGTGTCTTCAGGTGCAGGAAGG - Intronic
959894949 3:111594943-111594965 CTGTTTCAGCAGGAGGAGCTGGG + Exonic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960629053 3:119710377-119710399 CTGTGTCCTCACGTGGAGGAAGG + Intronic
961393213 3:126568995-126569017 CTGTGTCCCCTGGAGGCAGAGGG + Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
962411336 3:135143949-135143971 CTGTGCCTGGAGGAGGAGGCAGG - Intronic
962577858 3:136771102-136771124 CTGTGTCCTCATATGGAGGAAGG - Intergenic
965746247 3:171929113-171929135 CTGTGTCCTCATGTGGTGGAAGG - Intronic
965988894 3:174791402-174791424 CTGTGTCCTCACGTGGTGGAAGG - Intronic
966008462 3:175047023-175047045 CTGTGTCCTCAGATGGTGGAAGG + Intronic
966716652 3:183019467-183019489 CTGTGTCCTCACGTGGTGGAAGG - Intronic
967013111 3:185457479-185457501 CTGTGTCCTCACGAGGTGGAAGG + Intronic
967144938 3:186598511-186598533 ATGTGTGTGAAGGAGGAGGAAGG - Intergenic
968433278 4:572044-572066 GTGTGCCCGCAGGAATAGGAGGG + Intergenic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969547116 4:7837407-7837429 CTGTGTCCTCATGTGGCGGAAGG - Intronic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
972247275 4:37258662-37258684 GAGTGTCAGCAGGTGGAGGAAGG + Intronic
973576400 4:52294165-52294187 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
974837285 4:67266227-67266249 CTGTGTCCTCAGGTGGCAGAAGG + Intergenic
975533890 4:75428557-75428579 CTGTGTCCTCAGGGGCAGGAAGG - Intergenic
977381357 4:96278367-96278389 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
978530025 4:109703425-109703447 CTGTGGCTTCAGGAAGAGGAGGG - Exonic
979612391 4:122703142-122703164 CTGTTTCCAGAGGAAGAGGAGGG + Intergenic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982069324 4:151681824-151681846 CTGTGTCTGCATGTGGTGGAAGG + Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982206993 4:153004295-153004317 GTGTGTGGGGAGGAGGAGGAAGG + Intergenic
982212906 4:153055319-153055341 ATCTGGCCGCAGGAGGAAGAGGG + Intergenic
983608846 4:169620382-169620404 CTGGGTCTCGAGGAGGAGGAGGG - Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
984675975 4:182548140-182548162 CTGTGAGCCCAGGAGGTGGAGGG + Intronic
985300411 4:188482410-188482432 CTATGTCTGCAGGAGGAGAGTGG + Intergenic
985668787 5:1195874-1195896 CTGTGTCCCCAGGGGGTGGGAGG - Intergenic
987417144 5:17674247-17674269 CTCTGTCCTCATGTGGAGGAAGG + Intergenic
988100472 5:26669864-26669886 CTGCTGCCGCATGAGGAGGAAGG + Intergenic
989563355 5:42875899-42875921 CTGTGGCCCCCGGAAGAGGAAGG - Intronic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990449991 5:55924960-55924982 CTGGCTCCGCAGACGGAGGAAGG - Intergenic
990725811 5:58753631-58753653 CTGTCTTCACAGGAAGAGGAGGG + Intronic
992448654 5:76856051-76856073 ATGTGGCCGGAGGAGGAGGAAGG - Intronic
992563278 5:77973110-77973132 CGGTGGCCGCAGGCGGTGGATGG - Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993575378 5:89592924-89592946 CTGTGTCCGCACATGGTGGAAGG + Intergenic
996597569 5:125222907-125222929 CTGTGTCCGTTTGATGAGGAAGG + Intergenic
996995131 5:129686622-129686644 CTGTGTCCTTAGGAGAAAGAAGG + Intronic
997345927 5:133192015-133192037 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
997385245 5:133467371-133467393 CTGGGCCTGCAGGAGGAGGCTGG + Intronic
997709566 5:135992458-135992480 CTGTGTCCTCATGTGGTGGAAGG + Intergenic
997735019 5:136206800-136206822 CTGAGGCTGCAGGAAGAGGATGG - Intergenic
998565795 5:143214805-143214827 CTGGGTCAGCAGGAGTGGGAGGG + Intronic
999334190 5:150700905-150700927 GTGTGCCTGCCGGAGGAGGATGG - Intronic
999481185 5:151949549-151949571 CTGTGTCCCCACGTGGTGGAAGG - Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000194265 5:158942841-158942863 ATGTGGTCGAAGGAGGAGGAGGG + Intronic
1000245077 5:159442381-159442403 CTGAGAGCGCAGGAGGAGGAAGG - Intergenic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1001482762 5:172099943-172099965 CAGCGTCCTTAGGAGGAGGAAGG + Intronic
1002741994 5:181440698-181440720 CAGCCTCCGCAGGAGGAGGTGGG - Intergenic
1003191302 6:3877742-3877764 CTGTGTCCTTATGTGGAGGAAGG + Intergenic
1003493401 6:6642863-6642885 TCGTCTCCGGAGGAGGAGGAGGG - Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1003652841 6:7977198-7977220 CTGTGTCCTCATGTGGTGGAAGG + Intronic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1005809344 6:29504317-29504339 CTGTGTCCTCATGTGGTGGAAGG + Intergenic
1006153456 6:32001528-32001550 CGGGGTCTGCAGGACGAGGATGG + Exonic
1006159764 6:32034265-32034287 CGGGGTCTGCAGGACGAGGATGG + Exonic
1006945766 6:37783615-37783637 CGGTGTCTGGAGGAGGATGAAGG - Intergenic
1010133643 6:72524300-72524322 CTGTGCCAGCAGGAGCAGGTGGG - Intergenic
1010145155 6:72659607-72659629 CTGTGTCCTCACGTGGAAGAAGG + Intronic
1010519619 6:76817601-76817623 CTGTGTCTGCAGGGGCAGGGAGG - Intergenic
1011127698 6:84024356-84024378 CTGTGGCCTCAGGTGGAGGCAGG - Intergenic
1011555588 6:88568883-88568905 CTGTGTCCTTACAAGGAGGAAGG - Intergenic
1011556247 6:88573792-88573814 CTGTGTGCTCTGGAGAAGGAGGG - Intergenic
1011586659 6:88933403-88933425 GTGTGTGGGCAGGAGGAGCATGG - Intronic
1014441623 6:121480229-121480251 GTGTTTCCGCAGGAGGAAGTCGG - Intergenic
1015402125 6:132798636-132798658 CTGGGTCCCCGGGAGGAGGCCGG + Intergenic
1015494798 6:133869240-133869262 CTGTGTCCTCATGAGGCAGAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016795009 6:148108397-148108419 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1017346767 6:153391861-153391883 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1018040602 6:159918461-159918483 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1018471228 6:164100375-164100397 CTGGGACCACAGGAGAAGGAAGG - Intergenic
1018479915 6:164180003-164180025 CTGCGTCCTCACGAGGTGGAAGG - Intergenic
1018785340 6:167103669-167103691 CTGTGTCCGCACATGGTGGAAGG - Intergenic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1019060854 6:169256372-169256394 ATGTGTGCGCGGGAGGATGAGGG + Intergenic
1019080197 6:169425104-169425126 ATCTGTGCGCAGGAGGAGGCTGG + Intergenic
1019166754 6:170102299-170102321 GGGTGACCGCAGCAGGAGGAGGG + Intergenic
1019247131 6:170716436-170716458 CAGCCTCCGCAGGAGGAGGTGGG - Intergenic
1019560010 7:1651215-1651237 CTGGGTCCTCAGGCCGAGGATGG + Intergenic
1019625689 7:2014632-2014654 CTGTGTCCACAGGAGCGGGACGG - Exonic
1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1019773714 7:2899621-2899643 CTCTGGCTGCAGGAGGAGGAAGG - Intergenic
1019911009 7:4100581-4100603 CTGTGTCCTCACGTGGTGGAAGG - Intronic
1020180033 7:5915104-5915126 CCGTGACAGCAGGAGGAGGGAGG + Intronic
1020302901 7:6809778-6809800 CCGTGACAGCAGGAGGAGGGAGG - Intronic
1021808951 7:24384015-24384037 CTGTGTCCTCACAAGGTGGAAGG - Intergenic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1023253091 7:38286008-38286030 CTGTGTCCCAAGGAGAAGGCAGG + Intergenic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023770418 7:43551891-43551913 CTGTGTCTTCATGTGGAGGAAGG + Intronic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023879318 7:44309391-44309413 CTGAGCCAGCAGGAGCAGGAGGG + Intronic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1024997105 7:55280237-55280259 CTGGGTCTGCAGGAGGGGGTTGG - Intergenic
1025769953 7:64495187-64495209 CTGGCTCCGCAGGCTGAGGAGGG + Intergenic
1026934025 7:74241656-74241678 CTGTGTCAGAAAGAGAAGGATGG + Intronic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1029537174 7:101163612-101163634 CTGTTCGCGGAGGAGGAGGACGG - Exonic
1030422163 7:109321158-109321180 CTGTGTCCTCACTAGGTGGAAGG + Intergenic
1033109136 7:138559408-138559430 CTTTGCCCCCAGGAGGAGGTTGG + Intronic
1034309399 7:150073189-150073211 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1034330040 7:150274632-150274654 CTGCGTCCTCAGGTGCAGGATGG - Intronic
1034668015 7:152835229-152835251 CTGCGTCCTCAGGTGCAGGATGG + Intronic
1034797460 7:154027453-154027475 CTGTGTCCTCATGTGGTGGAAGG + Intronic
1034855455 7:154541912-154541934 CTGTGTCCCAGGGAGAAGGAAGG + Intronic
1035122439 7:156579615-156579637 CTGTGCCTGCAGGGTGAGGAAGG + Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035238086 7:157513189-157513211 CTGTGTCATCAGGCTGAGGAGGG + Intergenic
1035455474 7:159006140-159006162 CTGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455503 7:159006254-159006276 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455527 7:159006368-159006390 CTGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455537 7:159006406-159006428 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455546 7:159006444-159006466 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455554 7:159006482-159006504 CTGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455563 7:159006520-159006542 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035461097 7:159039660-159039682 CTGTGTCCTCACGTGGTGGAAGG - Intronic
1035501006 8:91498-91520 CAGCCTCCGCAGGAGGAGGTGGG + Intergenic
1037896353 8:22658899-22658921 CTGTCTCGGCAAGAGCAGGAAGG + Intronic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1038532246 8:28327931-28327953 CTGTGTCCTCAAGTGGTGGAAGG + Intronic
1039410626 8:37352286-37352308 ATGTGGCTCCAGGAGGAGGAGGG + Intergenic
1040552703 8:48450748-48450770 CTGTGTCTGGATGAGGGGGAAGG + Intergenic
1040984555 8:53279634-53279656 CTGTGTCTTCAGGTGGGGGAAGG - Intergenic
1041021650 8:53644085-53644107 CTGTCTCAGCAGGTGAAGGAAGG - Intergenic
1041178690 8:55225536-55225558 CTGTCTCCATAGGAGGAGAATGG - Intronic
1041258209 8:55997485-55997507 CTGTGTCCTCACGTGGTGGAAGG + Intronic
1042039467 8:64577196-64577218 CTCTGTCCGCAGCAGGGGTATGG - Intergenic
1042057600 8:64782387-64782409 CTGTGCCCTCATGTGGAGGAAGG - Intronic
1042194587 8:66221486-66221508 CCCTGTCAGCAGGAGGAGGTAGG - Intergenic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1042866248 8:73358930-73358952 CTGTGTCCTTACGTGGAGGAAGG - Intergenic
1042882902 8:73513883-73513905 CTGAGTCTGCAGGTGGGGGATGG + Intronic
1044592069 8:93922945-93922967 CTGGGTGTGCAGGAAGAGGACGG + Exonic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1045395266 8:101754509-101754531 CTGTGTCCTCATGTGGTGGAAGG + Intronic
1045468870 8:102493479-102493501 CTGTGTCCTCACGTGGTGGAAGG - Intergenic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1046637226 8:116683388-116683410 CTGTGTCCTCAGGTGGCAGAAGG + Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1049372193 8:142273217-142273239 CTGGGACGGCAGGAGGACGATGG - Intronic
1049654357 8:143791290-143791312 CCAGGCCCGCAGGAGGAGGATGG - Exonic
1049695969 8:143984487-143984509 TTGAGTCCCCAGTAGGAGGAGGG + Intronic
1050090843 9:2015871-2015893 GGGTGGCCGCAGGAGGGGGAAGG + Intronic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1051154566 9:14126483-14126505 CAGTCTCCCCAGGATGAGGAAGG + Intronic
1056574319 9:87843338-87843360 CTGTGGCCCCAGGAGGTGGGTGG - Intergenic
1056655576 9:88505989-88506011 CTAGGTCAGCAAGAGGAGGAGGG - Intergenic
1056761846 9:89421073-89421095 CCGTGTGTGCAGGAGGAGGCTGG - Intronic
1056789988 9:89618949-89618971 CTGTGTCCCCACGTGGTGGAAGG - Intergenic
1056945062 9:90987683-90987705 CTGTTTCTGCAGGTAGAGGAGGG - Intergenic
1057318805 9:93992653-93992675 CTGTGTCCTCTGGAGGAGAAGGG - Intergenic
1058114788 9:101072483-101072505 CTGTGTGCCCAGGAAGAGAAGGG + Intronic
1058418349 9:104811239-104811261 CTCAGTCTTCAGGAGGAGGAAGG - Intronic
1058560844 9:106227269-106227291 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1058756568 9:108088210-108088232 CTGAGTCCCCAGGAGGAGAAGGG - Intergenic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG + Intergenic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1062068088 9:134539768-134539790 CTGTGGCCGAGGGAGAAGGATGG + Intergenic
1062068500 9:134541633-134541655 CTGTGTCATGAGGATGAGGAGGG + Intergenic
1062688869 9:137831048-137831070 CTGTGTCCCCACGTGGTGGAGGG + Intronic
1203607906 Un_KI270748v1:71914-71936 CAGCCTCCGCAGGAGGAGGTGGG - Intergenic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1186410397 X:9341131-9341153 ATGTGTCTGTAGGAGGGGGAAGG - Intergenic
1187641516 X:21295835-21295857 CTTTGACTGCAGCAGGAGGATGG - Intergenic
1189068374 X:37836360-37836382 CTGTGTCCTCACAAGGTGGAAGG - Intronic
1189560234 X:42184763-42184785 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1192171452 X:68857900-68857922 CTGTGTCCTCACGTGGTGGAAGG + Intergenic
1193851368 X:86541819-86541841 GTGTGTGTGCATGAGGAGGAAGG + Intronic
1195625088 X:106999523-106999545 CCGGCTCCGCAGGCGGAGGAGGG - Intronic
1198393932 X:136204674-136204696 GTGTGTCAGCAGGAGGCAGAAGG + Intronic
1198822444 X:140662974-140662996 CAGTGGCCGCAGGAGAAGCAGGG - Intergenic
1198896709 X:141463564-141463586 CTGTGTCCTCAAGTGGTGGAAGG + Intergenic
1200124399 X:153806444-153806466 GTGTATCCCCAGGAGGGGGATGG - Intronic
1200179092 X:154139590-154139612 CTGTGTCCTCATCAGGAAGATGG - Intergenic
1200834415 Y:7718864-7718886 CAGAGTCCGCAGGAGAAGAATGG - Intergenic