ID: 1114633274

View in Genome Browser
Species Human (GRCh38)
Location 14:24172945-24172967
Sequence AAGCGGGGCCGCGGCAGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114633274_1114633283 10 Left 1114633274 14:24172945-24172967 CCCGGCCTGCCGCGGCCCCGCTT 0: 1
1: 0
2: 0
3: 28
4: 249
Right 1114633283 14:24172978-24173000 CTCTCAGCCCAACTTCAGATCGG 0: 1
1: 1
2: 1
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114633274 Original CRISPR AAGCGGGGCCGCGGCAGGCC GGG (reversed) Exonic