ID: 1114633657

View in Genome Browser
Species Human (GRCh38)
Location 14:24175305-24175327
Sequence CTTCTTGCACAAATTGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114633647_1114633657 22 Left 1114633647 14:24175260-24175282 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG 0: 1
1: 0
2: 0
3: 14
4: 156
1114633651_1114633657 -9 Left 1114633651 14:24175291-24175313 CCACCGAGCCCGGCCTTCTTGCA 0: 1
1: 0
2: 21
3: 287
4: 2091
Right 1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG 0: 1
1: 0
2: 0
3: 14
4: 156
1114633649_1114633657 18 Left 1114633649 14:24175264-24175286 CCAAAGTGCTGGGATTACAGACA 0: 4124
1: 101521
2: 240356
3: 245391
4: 213829
Right 1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG 0: 1
1: 0
2: 0
3: 14
4: 156
1114633648_1114633657 19 Left 1114633648 14:24175263-24175285 CCCAAAGTGCTGGGATTACAGAC 0: 8926
1: 233921
2: 277195
3: 180913
4: 143944
Right 1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG 0: 1
1: 0
2: 0
3: 14
4: 156
1114633645_1114633657 28 Left 1114633645 14:24175254-24175276 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG 0: 1
1: 0
2: 0
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114633657 Original CRISPR CTTCTTGCACAAATTGATGA GGG Intronic
900933501 1:5751149-5751171 CTTCTTTCACAGATTGAGGGAGG + Intergenic
901074645 1:6546009-6546031 CTTTTTTCTCAAATTGTTGAAGG - Intronic
901881055 1:12194053-12194075 CTTCCTGAACAAGTGGATGAAGG - Intronic
902438856 1:16416132-16416154 CTTGTGGCACAGATGGATGAAGG - Intronic
909597416 1:77422145-77422167 CTTCTTGATCAAACTGATGTAGG - Intronic
909840501 1:80315661-80315683 CTTTTTGAACAAATGAATGAAGG + Intergenic
910725862 1:90338100-90338122 CTTCATCTACAAAATGATGATGG + Intergenic
911476626 1:98381304-98381326 ATGCTTGCCCACATTGATGAGGG + Intergenic
912716321 1:111986541-111986563 TTGCTTTCACAAATTGAGGATGG - Intronic
913441522 1:118903273-118903295 CCTCTTTTGCAAATTGATGATGG + Intronic
916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG + Intergenic
918091736 1:181301426-181301448 TTTCCTACACAAACTGATGAGGG - Intergenic
918964532 1:191325018-191325040 CTTTTTTCACAAATTAAAGAGGG - Intergenic
920093244 1:203469352-203469374 CTTGGTGCACAAATGGATGTGGG + Intergenic
921742608 1:218703458-218703480 CTTCTTGTTCACTTTGATGAGGG + Intergenic
921910220 1:220540405-220540427 ATGCTTGCCCACATTGATGAAGG + Intronic
1063269418 10:4489643-4489665 CTACTTGTACAATATGATGAAGG + Intergenic
1066069678 10:31794804-31794826 CTTCTTGAAGAAATTGCAGATGG - Intergenic
1067975020 10:51014614-51014636 CTTACTGCACAAATTACTGAAGG + Intronic
1069864558 10:71493592-71493614 CTTCCTGAACAAATAGATGTGGG + Intronic
1070195077 10:74149850-74149872 CTTCATGCCCCAAATGATGAAGG + Intronic
1070606741 10:77903857-77903879 CTTCCTGCACTAATTGAAGTGGG - Intronic
1070996580 10:80788872-80788894 CTTCTGGCACAAAATAATAAAGG - Intergenic
1071432744 10:85619115-85619137 CTTCTTGCACATATCTGTGAAGG - Intronic
1072390909 10:94986107-94986129 CTTCATCCAGAAAGTGATGAGGG - Exonic
1073122371 10:101130645-101130667 CTTCTTAGACAAATTCAGGAAGG - Exonic
1074242540 10:111653434-111653456 GTTCTTGTAAAAATTGATGCAGG - Intergenic
1076113366 10:127878221-127878243 CTTCTGGTAGAAAATGATGATGG + Exonic
1077166412 11:1141438-1141460 CCTCTGGCACAGATTAATGAAGG - Intergenic
1078900969 11:15642510-15642532 CTCCTTGCCAAAAATGATGATGG - Intergenic
1081622264 11:44625579-44625601 CTTATTGCATAGATTGATGGAGG - Intergenic
1082870449 11:57939610-57939632 TTTCTTGGACAAAGAGATGAAGG - Intergenic
1082973274 11:59045866-59045888 ATTCTTCCACAAATTGCTAATGG - Intergenic
1084861855 11:72024082-72024104 CTTCTTACACCAACTGATGAAGG + Intronic
1085182173 11:74545188-74545210 CTAGTTGCCCTAATTGATGAGGG + Intronic
1085793833 11:79519002-79519024 CTTCTTGCAGACATTGAGGCAGG + Intergenic
1086402528 11:86472375-86472397 ATTCTGGCAGAAATGGATGATGG + Intronic
1087319777 11:96643890-96643912 CTTCTTGCAGAAATTGCTGTGGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1098986497 12:77018052-77018074 CTTCATGCACAAATTGCAGCAGG - Intergenic
1104272126 12:127292130-127292152 ATGCCTGCACACATTGATGAGGG - Intergenic
1110350142 13:74497206-74497228 CTTCTAGCACACTTTGATGTTGG + Intergenic
1111903190 13:94225159-94225181 CTTCATGCCCTAATTGAAGAGGG - Intronic
1111977064 13:94977562-94977584 CTTCTTGCACAAATTGTCATTGG - Intergenic
1112489183 13:99846910-99846932 ATACCTGCAGAAATTGATGATGG + Intronic
1112493348 13:99886154-99886176 CTTCTGGCACATTCTGATGACGG - Intronic
1112581903 13:100683484-100683506 CTTCTTGCACTAAGTCCTGAAGG - Intergenic
1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG + Intronic
1117441648 14:55765847-55765869 ATACTTGCCCAAATTTATGAAGG + Intergenic
1117949611 14:61068993-61069015 CTTCAGGCACAAAGAGATGAAGG - Intronic
1119666389 14:76488207-76488229 TTCCTTGCACAAAATGAAGAAGG + Intronic
1121944532 14:98106592-98106614 TTTCTTTAAAAAATTGATGATGG + Intergenic
1123385830 15:19800934-19800956 CTTCTTGCACAATCTGAAGGTGG - Intergenic
1123826669 15:24088900-24088922 CTTCTCACACAAAGTGATGTAGG - Intergenic
1124384368 15:29194433-29194455 CTTTGTACACAAATTCATGAGGG + Intronic
1126429968 15:48572702-48572724 ACTCTAGCACAAATTCATGATGG + Intronic
1127181111 15:56419052-56419074 CTGCTTGGAAAAATTGAAGAAGG - Intronic
1128794675 15:70456892-70456914 CTTCGTGCACAATTTGGGGAGGG + Intergenic
1130719310 15:86371363-86371385 CTTCATGCACAAAATTATGCAGG - Intronic
1132264601 15:100458105-100458127 CTTCTTTCATAAATTGCTGGTGG - Intronic
1139717148 16:68822733-68822755 CTTCTTCCACAAATTGGCCAAGG + Intronic
1139931999 16:70535212-70535234 CTTTCAGCACAACTTGATGATGG - Intronic
1143285407 17:5785392-5785414 CTTCTTGCACAAATGGAACCTGG - Intronic
1144351144 17:14397809-14397831 CTTTTTTCAGAAATAGATGAGGG - Intergenic
1146435164 17:32839042-32839064 ATTCTTGCAAAAATATATGATGG - Intronic
1154458309 18:14551263-14551285 CTTCTATCACAATTTTATGATGG - Intergenic
1156858327 18:41808729-41808751 CTCCTTGCATGAATTGAAGAGGG - Intergenic
1158061313 18:53347153-53347175 CTTCTGGCACAAAGTGGTGAGGG + Intronic
1158593158 18:58794305-58794327 CTTCCTGCACAAATAGAGGTGGG + Intergenic
1159138330 18:64362747-64362769 ATTGTTCCAAAAATTGATGAGGG + Intergenic
936554905 2:113487406-113487428 CTTCTTCCACAAATTTTTAAGGG + Intronic
940094254 2:149956199-149956221 CTTCTTCAACAGAGTGATGAGGG + Intergenic
941959151 2:171236481-171236503 CTTCTTTAACCAATTGATCAAGG - Intergenic
942072899 2:172331316-172331338 CTTCATGGAGAAATTGAGGAGGG + Intergenic
946139844 2:217681086-217681108 CTTCTGGCACAAACTGAAGAGGG + Intronic
946637198 2:221742691-221742713 CTTCCTGCTCAAACTTATGATGG - Intergenic
946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG + Intergenic
946920344 2:224574412-224574434 CTACTTGCTCAACTTGATAACGG - Intronic
947264769 2:228266521-228266543 CTGCCTGCACATATTGGTGATGG - Intergenic
947357292 2:229310300-229310322 ATTCTTGATCAACTTGATGAGGG + Intergenic
947693558 2:232162582-232162604 TTTCTTGCAGAAAGTGCTGAGGG + Intronic
1171348998 20:24488541-24488563 CTCCAGGCACAAACTGATGAAGG + Intronic
1174983848 20:55427426-55427448 TTTCTTTAACAATTTGATGATGG + Intergenic
1175414598 20:58793332-58793354 CTTCTGGCAGAACGTGATGATGG + Intergenic
1175678812 20:60969374-60969396 TTTCTGGCACAAATTTATGGAGG - Intergenic
1176716815 21:10357965-10357987 CTATTTGCACAAGGTGATGAGGG + Intergenic
1176815844 21:13602064-13602086 CTTCTATCACAATTTTATGATGG + Intergenic
1182634379 22:31712721-31712743 CTTGTTGCTCAAATCTATGAAGG + Exonic
1182680003 22:32071507-32071529 CTTCTTGCAGAGAGTGCTGAAGG - Intronic
1183306588 22:37086181-37086203 TTTTTTGCCCAAATTGAGGATGG - Intronic
949304816 3:2627992-2628014 TTTTGTGTACAAATTGATGAGGG + Intronic
950103343 3:10372039-10372061 CTTCTCCCAGAAAATGATGAAGG - Exonic
950108916 3:10406002-10406024 CTTCATGTACAAAATGATGTTGG + Intronic
953851214 3:46466725-46466747 CTTATTGCAATTATTGATGATGG - Intronic
956674096 3:71718737-71718759 CTTCTTGCAGAAAAGTATGAGGG - Intronic
957313001 3:78543584-78543606 CTTCTTTGCCACATTGATGATGG - Intergenic
959442841 3:106399876-106399898 CTTCTTGCACAGATTCCTAAAGG - Intergenic
964651346 3:159015030-159015052 CTTCTTGCCCTACTTCATGAAGG + Intronic
967102570 3:186228458-186228480 CTTTTTGAACAGATTAATGAAGG - Intronic
970336627 4:15052563-15052585 CTTCCTCCAGATATTGATGAAGG + Exonic
971930123 4:33070763-33070785 CTTCTTGTTCAAATTGCTGAAGG - Intergenic
973121575 4:46526643-46526665 TTTCTTGCAGAAATATATGAAGG - Intergenic
974353951 4:60788059-60788081 TTTATTGCACAAAATGCTGAGGG - Intergenic
974909511 4:68099928-68099950 CTTCTTGTACAAATTTATTTTGG - Intronic
977376781 4:96215578-96215600 CATTTTGAACAAATTGATAATGG + Intergenic
977488198 4:97676381-97676403 CTTGTTGGAAAAATTGATGTAGG - Intronic
979851637 4:125578420-125578442 TTACTTGCAAAAATTGTTGAGGG - Intergenic
980469003 4:133226472-133226494 CTTCCTGTCCAAATTTATGATGG - Intergenic
981171385 4:141627881-141627903 TTTCTTGTACAACTTGATGAAGG - Intergenic
981205014 4:142030514-142030536 CTTCTTGCACAAAGAGCTAAAGG - Intronic
982490142 4:156020003-156020025 CATCTTACACATATTGATTAAGG - Intergenic
986075174 5:4328825-4328847 TTTCCTGTACAAAGTGATGATGG + Intergenic
989222213 5:38980158-38980180 CTTCTTGAACAAATTAATCGGGG + Intronic
990855549 5:60262922-60262944 CTTCTTGCACAAATAGGTGGTGG - Intronic
993614679 5:90097021-90097043 CTTTGTGCTCCAATTGATGATGG - Intergenic
995217781 5:109614862-109614884 TTTCTTGTAAAAATTGATGAGGG + Intergenic
995780285 5:115767931-115767953 CCTCTTGCACAGATTGCAGATGG - Intergenic
996110079 5:119555220-119555242 ATTCTTGTCCAAAGTGATGATGG + Intronic
997251929 5:132395796-132395818 CTTCTTGCACAAATGTATCTTGG + Intergenic
997465742 5:134087009-134087031 CTTTTATCACAAATTCATGAGGG + Intergenic
998896449 5:146805222-146805244 CTTCATGCACAAATGGCTCAGGG - Intronic
1001286774 5:170429471-170429493 CTTGTTGTACAAATTTATGGGGG + Intronic
1007211124 6:40194134-40194156 GTTCTTGAACAAATTGCTTAAGG + Intergenic
1009696580 6:67112961-67112983 CTTCTGGCAGAAGGTGATGATGG - Intergenic
1010337159 6:74700109-74700131 CTTCCTCCACAAAATGAGGATGG - Intergenic
1010904067 6:81464517-81464539 CTTTTTGGACAAATTAAAGAAGG - Intergenic
1022949794 7:35326748-35326770 CTTCTGGCACAAAATGATGTTGG - Intergenic
1023612889 7:41989114-41989136 CTTCTTAAGCAAATTGATTAGGG + Intronic
1024022770 7:45386745-45386767 CTTGTTGGAAAAATTGGTGAAGG + Intergenic
1024332232 7:48167554-48167576 CTTCTTGCACAAATTTGTTTAGG - Intergenic
1029885101 7:103861086-103861108 CTCCTTGCATAAAGTGAGGAGGG + Intronic
1030005523 7:105114871-105114893 TTTGTTGGACAAATTGAGGATGG - Intronic
1034152932 7:148930882-148930904 CTTATTTGACAAATGGATGAGGG + Intergenic
1036677301 8:10845394-10845416 GTTCATGCACTAATTGAAGAGGG - Intergenic
1036963423 8:13270582-13270604 CTGATTCCACACATTGATGAGGG - Intronic
1040281771 8:46056497-46056519 CTTTTTGTAGAATTTGATGAGGG + Intergenic
1040642121 8:49347708-49347730 CTTCTTGCAAAAGTTTGTGAAGG - Intergenic
1041669063 8:60475089-60475111 TTTCTTGCACAAATAATTGAGGG - Intergenic
1042144343 8:65712413-65712435 CTTCCTACTCAAATTCATGAGGG - Intronic
1044974848 8:97654360-97654382 GTTCTTACACAAATTCAAGATGG - Intronic
1045876248 8:106984377-106984399 TTTCTGGCAAAAATTGATTAAGG - Intergenic
1046584352 8:116133164-116133186 CATCTTGGATAATTTGATGATGG + Intergenic
1047781188 8:128112474-128112496 TTTCTTTGACAGATTGATGAAGG - Intergenic
1047786674 8:128160165-128160187 CTTCTTGTACAAATTTTTGTTGG + Intergenic
1049898107 9:129778-129800 CTTCTTCCACAAATTTTTAAGGG - Intronic
1050662796 9:7901741-7901763 ATTCTTGCACAAATATATGGAGG - Intergenic
1051937431 9:22460017-22460039 CCTCTTGCAGAAAGTGAAGATGG - Intergenic
1052636517 9:31113153-31113175 CTGCTTGCACAGATTGCTGCTGG - Intergenic
1053341985 9:37344855-37344877 TTTTTTGAACAAATTAATGAAGG + Intronic
1053741177 9:41140076-41140098 CTTCTTCCACAAATTTTTAAGGG - Intronic
1054346385 9:63969564-63969586 CTTCTTCCACAAATTTTTAAGGG - Intergenic
1054444161 9:65296214-65296236 CTTCTTCCACAAATTTTTAAGGG - Intergenic
1054486111 9:65725291-65725313 CTTCTTCCACAAATTTTTAAGGG + Intronic
1054687172 9:68291221-68291243 CTTCTTCCACAAATTTTTAAGGG + Intronic
1055754579 9:79544026-79544048 CTTTTTAAACAAATTGATGCTGG - Intergenic
1059046257 9:110871215-110871237 TTTATTGGACAAATTGATGAAGG + Intergenic
1059835786 9:118150592-118150614 GTTCCTGCGCAAAATGATGAAGG - Intergenic
1059847950 9:118302491-118302513 CTTCTTGGAAAAAATGAGGAAGG + Intergenic
1059848295 9:118305987-118306009 CTTCTGGGACAAATTGTTGAAGG + Intergenic
1203531514 Un_GL000213v1:147397-147419 CTTCTATCACAATTTTATGATGG - Intergenic
1187610849 X:20941163-20941185 CTACTTCCACAAATTGCAGAAGG - Intergenic
1188673744 X:32913064-32913086 TTTCTTGCACTAAAAGATGAGGG + Intronic
1188721687 X:33529906-33529928 GTTCTTATACAAATTCATGAGGG + Intergenic
1193104016 X:77648659-77648681 CTTTTTGCACAGATTAATCAAGG + Intronic
1193648875 X:84105231-84105253 TTTCTGACACAAATTGATCAAGG + Intronic
1194106588 X:89776500-89776522 TTTCTGCCACAAATTGATCAGGG + Intergenic
1196053834 X:111333871-111333893 CTTTCTGCACAAAGAGATGAGGG + Intronic
1196759847 X:119191221-119191243 CTTCTTGAACACATGAATGAAGG - Intergenic
1200458552 Y:3424360-3424382 TTTCTGCCACAAATTGATCAGGG + Intergenic
1200681335 Y:6215092-6215114 CATATTCCACAAATTGATGCTGG + Intergenic
1200955133 Y:8937199-8937221 TTTCTTGCTCAAATTGGTGAGGG + Intergenic