ID: 1114634297

View in Genome Browser
Species Human (GRCh38)
Location 14:24178671-24178693
Sequence CTGTAAGAATGGTGGGGGTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 218}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114634283_1114634297 26 Left 1114634283 14:24178622-24178644 CCGAGAGGACCATCAGAGGCCCT 0: 1
1: 0
2: 0
3: 18
4: 221
Right 1114634297 14:24178671-24178693 CTGTAAGAATGGTGGGGGTTGGG 0: 1
1: 0
2: 1
3: 20
4: 218
1114634280_1114634297 30 Left 1114634280 14:24178618-24178640 CCGCCCGAGAGGACCATCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 1114634297 14:24178671-24178693 CTGTAAGAATGGTGGGGGTTGGG 0: 1
1: 0
2: 1
3: 20
4: 218
1114634287_1114634297 6 Left 1114634287 14:24178642-24178664 CCTGCGGAGTTGTTCAGAACCCC 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1114634297 14:24178671-24178693 CTGTAAGAATGGTGGGGGTTGGG 0: 1
1: 0
2: 1
3: 20
4: 218
1114634286_1114634297 7 Left 1114634286 14:24178641-24178663 CCCTGCGGAGTTGTTCAGAACCC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1114634297 14:24178671-24178693 CTGTAAGAATGGTGGGGGTTGGG 0: 1
1: 0
2: 1
3: 20
4: 218
1114634285_1114634297 17 Left 1114634285 14:24178631-24178653 CCATCAGAGGCCCTGCGGAGTTG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1114634297 14:24178671-24178693 CTGTAAGAATGGTGGGGGTTGGG 0: 1
1: 0
2: 1
3: 20
4: 218
1114634282_1114634297 27 Left 1114634282 14:24178621-24178643 CCCGAGAGGACCATCAGAGGCCC 0: 1
1: 0
2: 0
3: 20
4: 169
Right 1114634297 14:24178671-24178693 CTGTAAGAATGGTGGGGGTTGGG 0: 1
1: 0
2: 1
3: 20
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114634297 Original CRISPR CTGTAAGAATGGTGGGGGTT GGG Exonic
901061794 1:6475139-6475161 CTGGGAGGATGGTGGGGGTGGGG + Intronic
901418548 1:9134721-9134743 CTGTAAGCAAGGTGGGAGGTGGG - Intergenic
902742317 1:18447326-18447348 GTGTGTGTATGGTGGGGGTTGGG + Intergenic
902991013 1:20186875-20186897 CTGAAAGCCTGGTGGGGGTGTGG + Intronic
903340293 1:22649699-22649721 CTGTAAGAATCGTGGGGGCAGGG + Intergenic
903415075 1:23177061-23177083 CTGTAAGGATGATGGGGGGGGGG + Intronic
905034275 1:34907071-34907093 CTGGAAGAAAGGTGGGTGTGGGG - Intronic
905284563 1:36870909-36870931 CTGTCTGGGTGGTGGGGGTTGGG + Intronic
907429638 1:54404796-54404818 CTCTAAGAATAGTGGGGGGGGGG + Intronic
908510562 1:64847282-64847304 CCTTAGGAAAGGTGGGGGTTGGG + Intronic
910340809 1:86184802-86184824 TTGCAGGAATGGTGGGGGATGGG - Intergenic
911037701 1:93567852-93567874 CTGGAAGAAAGGTGGTGTTTTGG + Intronic
912223128 1:107700449-107700471 CTGTAAGCAGGGTGGGGGAAAGG - Intronic
913013960 1:114713968-114713990 CTGTAAGAATCCTGGGGGTGTGG + Exonic
916088527 1:161289052-161289074 CTGAAGGCCTGGTGGGGGTTGGG + Intergenic
917016982 1:170543236-170543258 CAGCAAGAGTGGTGGGGGATGGG - Intronic
917128706 1:171717074-171717096 CTGTACAACTGGTGGTGGTTTGG + Intronic
1062759885 10:10421-10443 CAGTTAGAAGGGTGAGGGTTAGG - Intergenic
1063938425 10:11103216-11103238 ATGTAAGCATGGTGTGGGGTTGG - Intronic
1064019270 10:11796299-11796321 CAGTCACAATGGTGGTGGTTAGG - Intergenic
1065109653 10:22427219-22427241 CTGGAAGAATGGTGGGGTGGAGG + Intronic
1065883000 10:30053203-30053225 GTGTATAAATGGTGGGGGGTGGG + Intronic
1071118772 10:82253817-82253839 ATGCAAGAATGGTGAGGTTTAGG - Intronic
1071990786 10:91099002-91099024 CTGTAAGAATAGTGTGGTCTTGG - Intergenic
1072896192 10:99368910-99368932 ATGGAAAAATGGTGGGGGTGAGG + Intronic
1073472710 10:103733058-103733080 CTCTGAGAATGGCGGGGGTGGGG - Intronic
1075575033 10:123571757-123571779 CTGTCAGGGTGGTGGGGGCTGGG + Intergenic
1077889243 11:6406787-6406809 CTGTGAGAGTGGTGGGGGAGAGG - Intronic
1080416621 11:32075016-32075038 ATGCAAGAAGGGTGGGGGATCGG - Intronic
1080499171 11:32852329-32852351 CTGGAAGTATGCTGCGGGTTTGG + Intronic
1083245139 11:61421042-61421064 CTGTGATAATGGTGGGTGATGGG - Intronic
1083834647 11:65258040-65258062 CTATCAGAATGGAGGGGGATAGG + Intergenic
1084397266 11:68920391-68920413 TTGAAAGAAAGGTGGGGGCTGGG - Intronic
1086377065 11:86212336-86212358 CTGTAAAAATGGTGGTGGGAGGG - Intergenic
1087590837 11:100185852-100185874 GTGCAAGAATGGTTGGGTTTGGG - Intronic
1089125963 11:116176752-116176774 CTCTCAGAATGGTGGGGGGAGGG + Intergenic
1089971963 11:122701057-122701079 GGGTCAGAATGCTGGGGGTTGGG - Intronic
1090514987 11:127415579-127415601 GTGAAAGAAGGGTGGGGGGTTGG - Intergenic
1090888850 11:130904843-130904865 CTGTAAAGATGGTGGGGGGCAGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092647494 12:10592233-10592255 CTGTAACATTGGTGGGGGGGCGG - Intergenic
1093647191 12:21600437-21600459 CTTTAAAAGTGGTGGGGGGTAGG + Intronic
1093881958 12:24414906-24414928 CTGTAAGTGTGCTGGGGATTTGG - Intergenic
1097719282 12:63002730-63002752 CTGTATGCATGGTGTGGGGTTGG + Intergenic
1098054599 12:66491456-66491478 CTGTCAGAGTGGTGGGGCTTGGG + Intronic
1098090927 12:66900318-66900340 CTTTTATAAGGGTGGGGGTTAGG - Intergenic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098271785 12:68776720-68776742 CTGGAAAAATGGCGGGGGTGGGG - Exonic
1098302533 12:69068902-69068924 CTGTATGAGTGTTGGGGGGTGGG - Intergenic
1099750058 12:86762026-86762048 CTGAAATAATGGTGAGGGATAGG + Intronic
1100635488 12:96431266-96431288 CAGTCAGAAAGGTGGGGGTGGGG + Intergenic
1101471030 12:104997390-104997412 CTTTAAGAATGCTGAGGGTGTGG + Intronic
1102925271 12:116821459-116821481 CTGTTAGGATGGTGGGGTTGTGG - Intronic
1104118655 12:125775377-125775399 CTTTCAGAAGGGAGGGGGTTTGG - Intergenic
1106130565 13:26936096-26936118 ATGCAAGAATGGTGGGGGCTTGG + Intergenic
1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG + Intronic
1114617167 14:24074468-24074490 CTGCAAGGAGGGTGGGGGATGGG - Intronic
1114634297 14:24178671-24178693 CTGTAAGAATGGTGGGGGTTGGG + Exonic
1116039543 14:39669108-39669130 TTGTAATAATGATGGGGGTGGGG + Intergenic
1116767165 14:49086766-49086788 CTCTAAGAAGGGTGGTGGGTGGG - Intergenic
1116799579 14:49429131-49429153 CTAGAAGCATGGTGGGGGATGGG - Intergenic
1118310600 14:64689867-64689889 TAGAAAGAAAGGTGGGGGTTGGG + Intergenic
1119685535 14:76628046-76628068 CTTAAAGGAGGGTGGGGGTTAGG - Intergenic
1120375784 14:83705382-83705404 CTGTAAGAATGAGGAGGATTAGG - Intergenic
1124831153 15:33150844-33150866 CTGGGAGAAAGGTGGGAGTTGGG + Intronic
1125765461 15:42132416-42132438 CTGCCACACTGGTGGGGGTTGGG - Intergenic
1126600334 15:50421975-50421997 GTTTAAGAGTGGTGGGGATTAGG - Intergenic
1126640156 15:50816323-50816345 CTGTAAGGTTGGTGGTGCTTAGG + Intergenic
1127254811 15:57280703-57280725 CTGAAAAAATGGTTGGGGGTGGG + Intronic
1129365829 15:75053758-75053780 CTGTTAGACTGGTGGGGGTGTGG + Intronic
1130843228 15:87721343-87721365 ATATAATAATGGTGGGGGTATGG + Intergenic
1131087537 15:89589316-89589338 GGGTAAGAAGGGTGGGTGTTTGG + Intronic
1131390223 15:92041928-92041950 CAGGAAGTATGGTGGGGGTGGGG + Intronic
1132429486 15:101748813-101748835 CTGTAAGAGTGGCTGGGGGTAGG - Intergenic
1133272433 16:4616733-4616755 CTGTGAGAACGGCTGGGGTTGGG + Intronic
1134059078 16:11188221-11188243 CTGGAAGACTGGTGGGGGCCTGG + Intergenic
1134610642 16:15605548-15605570 CTGTAGTGATGGTGGGGGTCTGG - Intronic
1137637027 16:49995813-49995835 CTGTAACAACAGTGTGGGTTGGG - Intergenic
1138588717 16:57987667-57987689 CTGGAGGACTGGTGGGGGGTTGG + Intronic
1138852330 16:60643756-60643778 CTTTAAAAATGATGGTGGTTGGG - Intergenic
1139167726 16:64589045-64589067 CTATAAGAATGATGTGGTTTTGG - Intergenic
1139392685 16:66614991-66615013 CTGTATGTATGGAGTGGGTTGGG - Exonic
1141057746 16:80834315-80834337 TTGTAACAATGGTGGGAGATGGG - Intergenic
1141632619 16:85296761-85296783 CTGTAAGAATGGAAGGAGTTAGG - Intergenic
1146470012 17:33116626-33116648 CTCCAGGAATGGTGGGGGGTGGG + Intronic
1148549972 17:48544496-48544518 CGGTAAGCGTGGTGGGGGTGGGG - Intronic
1148582199 17:48751988-48752010 CTGAAGGAAGGGTGGGGGCTGGG + Intergenic
1149070177 17:52532212-52532234 ATGACAGAATGGTGGGGGTGGGG + Intergenic
1149627157 17:58087968-58087990 GTGTAAGAATGGTGGCAGTCTGG + Intronic
1149730653 17:58942668-58942690 CTTTAAGATTTGTGGGGGTAGGG + Intronic
1151355119 17:73553696-73553718 CTGTAACAAGGGTGGGGGTTTGG - Intronic
1151473942 17:74334824-74334846 CTGTAAGAATGAAGGGGCTGTGG + Intronic
1152056731 17:78034466-78034488 CTGGAAGTAAAGTGGGGGTTGGG - Intronic
1152294659 17:79459606-79459628 CTCTAGGATTGGTGGGGGTGGGG - Intronic
1152952756 18:10617-10639 CAGTTAGAAGGGTGAGGGTTAGG - Intergenic
1153399442 18:4667079-4667101 ATGGCAGCATGGTGGGGGTTGGG - Intergenic
1153808651 18:8732807-8732829 CTGAAAGAATGTTGGGGGTGGGG + Intronic
1155373913 18:25135418-25135440 TTGGAAGGATGATGGGGGTTGGG + Intronic
1155565281 18:27127502-27127524 CAGTAAGAAAGGTGAGGGTGAGG + Intronic
1155698156 18:28709255-28709277 CTGTGACAATGGAGGGGCTTGGG + Intergenic
1156907398 18:42370299-42370321 TTGTAAGAATGGAGGAGGTGAGG + Intergenic
1157142234 18:45121040-45121062 TGGTAAGAATGGGGGTGGTTTGG - Intergenic
1162402564 19:10454676-10454698 CTATAAGACTGCTGGGGGGTTGG - Intronic
1165803830 19:38568362-38568384 CAGGAAGAAGGGTGGGTGTTGGG + Intronic
925591501 2:5514427-5514449 CTGTAAGCAGGGTGAGGGTATGG + Intergenic
925826963 2:7859031-7859053 CTGTAAGAAGGGAGGTGGTAAGG - Intergenic
926178140 2:10615823-10615845 CTTTAGGCATGGTGGGGATTTGG - Intronic
927697128 2:25246365-25246387 CTGTAAGGAGGGTGGGGGAAGGG - Intronic
929000881 2:37345533-37345555 CTGTAAGAAGTGTATGGGTTCGG + Intronic
929035035 2:37682580-37682602 TTGTAAGAATGGTGGTAGTATGG + Intronic
929152273 2:38758100-38758122 CTGTAGAGATGGTGGGGGTCAGG + Intronic
931578291 2:63744034-63744056 ATGTATGAAGGGTGGGGGTGTGG + Intronic
931635609 2:64338430-64338452 GTGAAACAATGGTGGGGTTTGGG + Intergenic
932140763 2:69275668-69275690 CTGTCAGGAAGGTGGGGGTTGGG - Intergenic
932765511 2:74466756-74466778 CTGTAAAAATGGGGGTGGTCTGG - Intergenic
933381194 2:81548218-81548240 CTTTAAGAATGGTTGGAATTTGG - Intergenic
942896647 2:181064437-181064459 CTGTAATAATGTTGGGGGTGGGG - Intronic
944129927 2:196336839-196336861 CTGTAGCACTGGTGGGGGTGGGG - Intronic
1169201131 20:3710729-3710751 ATGGAAGAATGGTGGGGTTCTGG + Intergenic
1169519415 20:6355033-6355055 CTGGAAGACTAGTGGGGGCTTGG - Intergenic
1170477102 20:16726348-16726370 TTTTAAGAATGGTTGGGGTCGGG - Intergenic
1170641672 20:18159666-18159688 TTGTAAGAATGGGGAAGGTTGGG - Intronic
1171020253 20:21578240-21578262 CTGCAAGCTTGGTAGGGGTTGGG + Intergenic
1172780060 20:37431316-37431338 CTGATAAGATGGTGGGGGTTGGG - Intergenic
1173273481 20:41557776-41557798 CTGATAGAGTGGTGGGGGATAGG - Intronic
1173705462 20:45107309-45107331 CTCTAAGAAGGGTGGAGGTCAGG + Intergenic
1173790476 20:45824703-45824725 CTCTAGGCAGGGTGGGGGTTGGG - Intronic
1175112485 20:56658321-56658343 TTGGGAGAAGGGTGGGGGTTGGG + Intergenic
1175164026 20:57030350-57030372 ATATAAATATGGTGGGGGTTGGG + Intergenic
1175609569 20:60339462-60339484 CTGCAGGACAGGTGGGGGTTTGG + Intergenic
1179223531 21:39431150-39431172 CTGTGAGAAAGGTGGTGGATTGG + Intronic
1179328998 21:40380567-40380589 CTGTTTAGATGGTGGGGGTTTGG + Intronic
1179456888 21:41506667-41506689 CTGAAGGAAGGATGGGGGTTGGG - Intronic
1181098731 22:20524471-20524493 CTCTCAGATTGGTGGGGCTTGGG + Intronic
1182479683 22:30599333-30599355 CTTTAAGGGTGTTGGGGGTTTGG + Intronic
949331611 3:2929908-2929930 CTGTAATTATGGTGGGAGTTTGG - Intronic
949487233 3:4551647-4551669 CTGTAAATATAGTGAGGGTTTGG - Intronic
950664646 3:14487954-14487976 CTGTGAGGATGGTGGGAGTGTGG - Exonic
950971260 3:17190649-17190671 CTGTCAGCATGGTGTGTGTTGGG - Intronic
955025270 3:55161422-55161444 CTGTAAGAATGGCTGGAGTTTGG + Intergenic
955452476 3:59084641-59084663 CTGTAAGATGGGTGGGAATTGGG - Intergenic
955890088 3:63640855-63640877 ATGTAATACTGGTGGGGGATGGG - Intergenic
956061595 3:65353626-65353648 CTGAAAGAATGTTGGGGGGGAGG - Intronic
956209307 3:66786826-66786848 CTGGAAGTGGGGTGGGGGTTGGG + Intergenic
956599257 3:71001579-71001601 ATGTACCAATGGTGGGGGGTGGG + Intronic
956815390 3:72903681-72903703 CTGGAAGAATGGTCAGGATTTGG + Intronic
958623152 3:96588854-96588876 CTGATAGAATGAAGGGGGTTGGG + Intergenic
959176249 3:102915253-102915275 CTGTAATATGGGTGGGTGTTAGG - Intergenic
960235062 3:115272662-115272684 CTTTTGGAATGGTTGGGGTTTGG + Intergenic
961140502 3:124551795-124551817 CTGTAAGCATGGTGCAGGTAGGG + Intronic
963554831 3:146773651-146773673 CTATAAGGATTGTGGGGGTGGGG - Intergenic
964091331 3:152879592-152879614 CTGAAAGAATGCTGGTGGTGTGG - Intergenic
964831451 3:160887870-160887892 CTTTAAGAATGTTGGAGGCTGGG - Intronic
964945253 3:162214738-162214760 CTGTTAAAATTGTGGGAGTTAGG - Intergenic
966550548 3:181199830-181199852 GTATAAGAGTGGTGGGGGCTTGG - Intergenic
966774364 3:183531127-183531149 CTGGAAGAATAGTGAGGGCTGGG - Intronic
967461395 3:189750966-189750988 CTGTCAGCAGGGTGGGGGTTTGG - Intronic
969173939 4:5385107-5385129 CTCTAAAGATGGTAGGGGTTGGG + Intronic
969510271 4:7613738-7613760 GTGTAAGGATGGTAGGGCTTAGG - Intronic
969660488 4:8524768-8524790 CTGGAAGTGTGGTGTGGGTTTGG - Intergenic
970676038 4:18451513-18451535 CAGTAAGTATGGTGGGGGTGGGG + Intergenic
972111745 4:35570322-35570344 CTGTAAGTAGGGAGGGAGTTGGG - Intergenic
972133661 4:35865039-35865061 ATGCAAGAGTGGTGGGGGCTTGG + Intergenic
972889828 4:43543101-43543123 CTTAAACAATGTTGGGGGTTAGG - Intergenic
972933577 4:44104427-44104449 ATGTTAGCATGGTGGGGGTGGGG + Intergenic
975104004 4:70548226-70548248 CTTTAAGAATGTTGGGGAATTGG - Intergenic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
977668031 4:99663574-99663596 ATGTAAGAATGGTGAGGGCTTGG - Intergenic
979601914 4:122594652-122594674 GTTTATGAATGGTGGGGGTGAGG - Intergenic
981018879 4:140004517-140004539 CAGTAAGAAAGGGAGGGGTTTGG + Intronic
982958957 4:161811037-161811059 CTATAATAATGGTAGGGGGTTGG - Intronic
983359961 4:166715604-166715626 GTGTAAGAATGGTTCAGGTTTGG - Intergenic
983404053 4:167302603-167302625 CTGTAAAAGTGGTGGGAGTGAGG - Intergenic
983827900 4:172287118-172287140 TTTTAAGAATGGTCTGGGTTAGG - Intronic
984549512 4:181144064-181144086 ATGAAAGCATGGTGGGGATTGGG - Intergenic
987017971 5:13839316-13839338 GAATAAAAATGGTGGGGGTTGGG + Intronic
987952238 5:24689952-24689974 CTGGAAGTATAGTGGGGGATTGG + Intergenic
993677901 5:90839507-90839529 CTGTAAGAGAGGTGGAGGCTGGG - Intronic
996470636 5:123856077-123856099 CTGGAAGAATGGTGGGAATAAGG - Intergenic
997361800 5:133299966-133299988 CTGTGAGGAAGGTGGGGCTTTGG - Intronic
997601390 5:135141092-135141114 CTCTAACAAGGGTGGGGGTAGGG + Intronic
998816345 5:146017836-146017858 CTGGAAGTATGGATGGGGTTGGG - Intronic
1001823329 5:174726219-174726241 CTGTAGGAAAGGTGAGGGTGGGG + Intronic
1004382341 6:15143358-15143380 CTGTAAATATGCTGGGGCTTGGG - Intergenic
1006214455 6:32428328-32428350 GTGTAGGGATGGTGGGGGGTGGG - Intergenic
1006833292 6:36981923-36981945 ATGTAAGAATGTTGGGGTGTGGG - Intronic
1006936614 6:37723277-37723299 CTGTGGGAAGGGTGAGGGTTGGG - Intergenic
1007713243 6:43838202-43838224 CTGTAGGACAGGTGGGGGATGGG + Intergenic
1010144718 6:72654219-72654241 CTGGAAGAGTGTTGGGGGTTTGG + Intronic
1010165589 6:72911414-72911436 GTGTCAGAATGGTGGGGTTCTGG - Intronic
1010850084 6:80764227-80764249 CTGGAAGAATGGTCTGGCTTAGG + Intergenic
1011383061 6:86763526-86763548 CTGTAGGAATGGTGTGGGACAGG + Intergenic
1011742987 6:90381917-90381939 CTGAAAGAATGGAGGGGGAGTGG - Intergenic
1012900535 6:105000110-105000132 CTGCAAAAATGGTGGGGGAGGGG + Intronic
1015239136 6:131004646-131004668 CTGGAGGAGTGGTGGGGGTAAGG - Intronic
1017731278 6:157318825-157318847 CTGTATGCATGGTGTGGGGTTGG - Exonic
1018217197 6:161540029-161540051 CATTCAGAATGCTGGGGGTTGGG + Intronic
1019415634 7:925479-925501 CTGGAAGGCGGGTGGGGGTTGGG - Intronic
1021172876 7:17417340-17417362 CTGTAGAAAGGGTTGGGGTTTGG - Intergenic
1022075623 7:26966878-26966900 CTGTAAGGATGGTGGGAGTGGGG + Intronic
1022773851 7:33503786-33503808 TTGTAATCATGGTGGGGGTGGGG + Intronic
1023029251 7:36078741-36078763 CTTAAATTATGGTGGGGGTTTGG - Intergenic
1023789055 7:43737544-43737566 CTGCAGGAATGTTGGGGGTTGGG - Intergenic
1024093269 7:45965080-45965102 ATGTACTAATGCTGGGGGTTGGG + Intergenic
1024106960 7:46099943-46099965 ATGAAAGAATGGTGGGGGAGAGG - Intergenic
1026946557 7:74319924-74319946 TTTTAAGAGTGGTGGGGGCTGGG + Intronic
1028302651 7:89220546-89220568 ATGTAACAATGGTGGAGGTGTGG - Intronic
1030983900 7:116218025-116218047 CTGTTAGAATGGTGGGGAGTCGG + Intronic
1035240205 7:157524214-157524236 CTGTGACAATCGTGGGGGTTCGG + Intergenic
1037812465 8:22095192-22095214 CTGTAGGAAAGGTGTGGGCTGGG - Intronic
1037935706 8:22913694-22913716 CGGTGTGAATGGTGGGAGTTAGG - Intronic
1042017170 8:64327126-64327148 CTTTAACCATGGTTGGGGTTTGG + Intergenic
1043018236 8:74968228-74968250 GTGTGAGAATGGTTGTGGTTTGG + Intergenic
1043398684 8:79862713-79862735 CTGGAAGAAGGCTGGGGGTTGGG - Intergenic
1045960216 8:107958694-107958716 CTGTAAGAATGGGGGCGATGCGG - Intronic
1046157564 8:110312951-110312973 CTGTAAAAATAGAGGGGATTGGG + Intergenic
1046830377 8:118739104-118739126 ATGTAGGAATGGTGAGGCTTAGG + Intergenic
1047060255 8:121217529-121217551 ATGTAGAAATGGTGGGGGTGGGG - Intergenic
1048190230 8:132281712-132281734 CAGTAAACATGGTGGTGGTTGGG - Intronic
1048511546 8:135066793-135066815 CTGTTACAATACTGGGGGTTAGG + Intergenic
1049309768 8:141927652-141927674 CTGGAAGAACGGCGGGGGTGGGG - Intergenic
1051816642 9:21115549-21115571 CTGAAAAAAAGGTGGGGGGTGGG + Intergenic
1052251432 9:26402336-26402358 CCATCAGAATGGTGGGGGATGGG - Intergenic
1054714779 9:68546576-68546598 CTGAAAGAAGGGTGAGGTTTTGG - Intergenic
1058873175 9:109219871-109219893 CTGTAAGGATGATGGAAGTTAGG + Intronic
1059765859 9:117383523-117383545 CTGTAACACTTGTGGGGGCTGGG + Intronic
1060458048 9:123819276-123819298 CTGTTAGGATGGTGAGAGTTTGG - Intronic
1061563360 9:131420827-131420849 CTGGAGGTGTGGTGGGGGTTGGG + Intronic
1062366466 9:136211776-136211798 CTGGAAGACTGGTGGGAGGTGGG - Intronic
1188166577 X:26871051-26871073 GTGCAAGAGTGGTGGGGGCTTGG - Intergenic
1192196617 X:69033017-69033039 CTGGAGGGATGGTGGGGGTGGGG - Intergenic
1192283276 X:69706621-69706643 CTCGAAGAAGGGTGGGGGTGGGG + Intronic
1192491495 X:71579828-71579850 AGGTGAGAATGGTGGGGGTAGGG + Intronic
1193313021 X:80030012-80030034 TTCCACGAATGGTGGGGGTTGGG + Intronic
1193760470 X:85459924-85459946 TTGAAAGGGTGGTGGGGGTTAGG + Intergenic
1196148308 X:112344246-112344268 CTGTAAAAGAGGTGGGTGTTAGG - Intergenic
1196176724 X:112646424-112646446 ATGAAAGATTGGAGGGGGTTTGG - Intronic
1196551252 X:117028404-117028426 GTGTAAGAGAGGTGGGAGTTGGG - Intergenic
1197566433 X:128093960-128093982 CTGTATCAATGGTGTTGGTTGGG + Intergenic
1199851314 X:151726511-151726533 CTCCAAGAAGGGTTGGGGTTAGG - Intergenic