ID: 1114635791

View in Genome Browser
Species Human (GRCh38)
Location 14:24186078-24186100
Sequence GACTAGGCACACTTGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114635778_1114635791 19 Left 1114635778 14:24186036-24186058 CCTTCACACCTCCCAGGGTCTAA 0: 1
1: 0
2: 5
3: 16
4: 210
Right 1114635791 14:24186078-24186100 GACTAGGCACACTTGGAGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 102
1114635782_1114635791 7 Left 1114635782 14:24186048-24186070 CCAGGGTCTAAACGTCGTTGGCC 0: 1
1: 0
2: 1
3: 1
4: 14
Right 1114635791 14:24186078-24186100 GACTAGGCACACTTGGAGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 102
1114635779_1114635791 11 Left 1114635779 14:24186044-24186066 CCTCCCAGGGTCTAAACGTCGTT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1114635791 14:24186078-24186100 GACTAGGCACACTTGGAGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 102
1114635781_1114635791 8 Left 1114635781 14:24186047-24186069 CCCAGGGTCTAAACGTCGTTGGC 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1114635791 14:24186078-24186100 GACTAGGCACACTTGGAGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114635791 Original CRISPR GACTAGGCACACTTGGAGGT AGG Intronic
900565807 1:3331299-3331321 CCCCCGGCACACTTGGAGGTGGG + Intronic
902155822 1:14485463-14485485 GACAAGCCACACTGGTAGGTGGG - Intergenic
905917598 1:41696416-41696438 GACGAGGCACATTTTAAGGTGGG + Intronic
906351284 1:45062183-45062205 GACTATTGTCACTTGGAGGTAGG - Intronic
907695878 1:56728441-56728463 GACTGGGAACTCTTTGAGGTAGG - Intronic
908114454 1:60927267-60927289 GACAAGGCACACATTGAGTTTGG - Intronic
912642704 1:111362401-111362423 GCCTAGGTACACTTAGAGTTAGG + Intergenic
914513920 1:148357550-148357572 GACAAGGGAAGCTTGGAGGTTGG - Intergenic
915587559 1:156852391-156852413 GACTAGGCACTGTGGGAGGTGGG - Intronic
917453188 1:175164075-175164097 GAGAAGGGACACTAGGAGGTAGG + Intronic
919641359 1:200047974-200047996 GACGACACACACTTGGAGGAAGG + Intronic
920866330 1:209756894-209756916 GACTGGGCTCACTTAGAGCTTGG - Intronic
922322998 1:224503936-224503958 GGGAAGGCAAACTTGGAGGTGGG + Intronic
922631885 1:227123661-227123683 GACTAGACCCAGTGGGAGGTTGG + Intronic
923007070 1:230058468-230058490 CACTTGGCACACTTGCCGGTGGG - Intronic
1063948372 10:11199555-11199577 GAGAAGGCACACTTGGGGGAAGG - Intronic
1069577840 10:69543552-69543574 GGCTGGGCACACTTGTAGGTGGG + Intergenic
1069628611 10:69883309-69883331 GAATGGGCACACTTTGAGGTAGG - Intronic
1071712586 10:88064143-88064165 GACTAGTGACACTAGGATGTGGG - Intergenic
1074201476 10:111239917-111239939 GACAAGGCACACTTGAAGCAAGG + Intergenic
1081290510 11:41319652-41319674 GACTAGCCACCCTGGGAGGTGGG - Intronic
1091710369 12:2735757-2735779 GACAAGGCACAGTTGGTGGGGGG + Intergenic
1093369464 12:18349802-18349824 GACCATGCACATTTGTAGGTAGG + Intronic
1098104909 12:67059401-67059423 GACTTGGCACATTTGGTGGCTGG - Intergenic
1106028628 13:25978363-25978385 GATCAGTCACAGTTGGAGGTAGG - Intronic
1114635791 14:24186078-24186100 GACTAGGCACACTTGGAGGTAGG + Intronic
1116938777 14:50769958-50769980 GAAAAGGCACATTTGGAGGCCGG + Intronic
1117661110 14:58005882-58005904 GACAAGACAAAGTTGGAGGTTGG + Intronic
1120745829 14:88150519-88150541 GACTAGGAAGGGTTGGAGGTTGG - Intergenic
1125764389 15:42123524-42123546 GGCTATGCCCACTTGCAGGTTGG + Intergenic
1132424292 15:101701421-101701443 TACTTGGCACACTTGGAGTACGG + Intronic
1134059486 16:11190562-11190584 GACTAGGGACAAGTGGAGGGAGG - Intergenic
1143518329 17:7431053-7431075 GACTGAGGAGACTTGGAGGTTGG - Intergenic
1143908192 17:10226602-10226624 GAATAGGGGGACTTGGAGGTGGG - Intergenic
1146724956 17:35149020-35149042 GACAGGGCAAGCTTGGAGGTGGG - Intronic
1146792887 17:35762762-35762784 GGCAAGGCCCACTTGGAGGAAGG + Intronic
1146826129 17:36024657-36024679 GGGTAGGCACACTGGGTGGTAGG - Intergenic
1148897258 17:50846060-50846082 GACTAGCCTCTCCTGGAGGTGGG + Intergenic
1150105229 17:62457812-62457834 GAAAAGGCACACTCTGAGGTTGG + Intergenic
1151198034 17:72445747-72445769 GGCCAGGCACACCTGGACGTCGG + Intergenic
1151698679 17:75731169-75731191 TGCCAGCCACACTTGGAGGTTGG + Intronic
1151880840 17:76893579-76893601 GACTGGGTGCACTTGGTGGTGGG + Intronic
1151986904 17:77549397-77549419 GAACAGACACACATGGAGGTTGG - Intergenic
1155027547 18:21956243-21956265 GTCTAGGCAGTCTAGGAGGTGGG + Intergenic
1156291941 18:35755094-35755116 GACCAGGAACACTGGGATGTAGG + Intergenic
1161568205 19:5015199-5015221 GACTTGGCACACCTGGGGCTCGG - Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165908320 19:39207424-39207446 GACTGGAAACACTTGGAAGTGGG + Intergenic
930992124 2:57668981-57669003 GAGTAAGAACACGTGGAGGTTGG - Intergenic
931393185 2:61862383-61862405 GAATCAGCACACTTGGAGGTAGG - Intergenic
933616991 2:84492247-84492269 CAGTAGGCACATTTGAAGGTGGG - Intergenic
935021914 2:99240097-99240119 GATTAGGTACACCTGGAGGTTGG - Intronic
937163014 2:119783925-119783947 GGGTTGGAACACTTGGAGGTGGG + Intronic
939584436 2:143989528-143989550 GATTAGGCAGACATGGAGGAGGG + Intronic
941317636 2:164014473-164014495 GATTAGTCACACTTTGAGGCAGG + Intergenic
944274293 2:197818398-197818420 GACAAAGTAGACTTGGAGGTTGG + Intronic
947228617 2:227863453-227863475 AATTAGTCACAGTTGGAGGTAGG + Intergenic
1168980524 20:1999623-1999645 GAGTAGGCAAACTCTGAGGTGGG + Intergenic
1172479175 20:35260887-35260909 GCCTAGGGACACATGGGGGTGGG - Intronic
1174951651 20:55048583-55048605 GACAAGGGAGAATTGGAGGTTGG - Intergenic
1175061387 20:56247116-56247138 GACTTGGAAGACTTGGAGGGTGG - Intergenic
1177123098 21:17162811-17162833 GACAAGAAATACTTGGAGGTTGG - Intergenic
1178607685 21:34053931-34053953 GAGGAGGCATTCTTGGAGGTGGG - Intergenic
1179778822 21:43686488-43686510 CACTAGGGACACTTGGAATTGGG + Intronic
1179976648 21:44872285-44872307 CCCTAAGCACACTTGGAGGCAGG + Intronic
1184419032 22:44368926-44368948 GCCAAGGAACATTTGGAGGTTGG - Intergenic
1185149712 22:49157159-49157181 GCCCAGGCGCACTTGGAAGTGGG + Intergenic
958983148 3:100748444-100748466 GATTAGGCCCACTTGGAGGAGGG - Exonic
965282457 3:166771164-166771186 GACTAGGGACAGTTGGAGAGGGG + Intergenic
969240879 4:5896470-5896492 GACTAGGAGCAGTTGGAGGATGG - Intergenic
975093307 4:70427997-70428019 GACTTGGCACACTAGTGGGTTGG - Intergenic
977839193 4:101681038-101681060 GACTAGGCATGCTTAGGGGTAGG + Intronic
994953588 5:106498044-106498066 GACTATGTACACCTGGAGTTTGG - Intergenic
995295018 5:110510292-110510314 GACAAGGCAGAGTTGGGGGTAGG - Intronic
996831273 5:127743171-127743193 GTCTAGGCAGTCTTGGTGGTTGG - Intergenic
997996903 5:138594129-138594151 CACTGGCCACACTGGGAGGTAGG - Intergenic
1000003866 5:157165389-157165411 GACTTACCACACTGGGAGGTGGG - Intronic
1000527149 5:162371452-162371474 GAGTTGGCACAGTTGGAGGTAGG + Intergenic
1004279836 6:14271242-14271264 CACTAGCCACACTGGGCGGTAGG + Intergenic
1007027223 6:38588450-38588472 GATTAGGCCCAGTTGGAGGAGGG - Intronic
1008503722 6:52208851-52208873 TATGAGCCACACTTGGAGGTGGG - Intergenic
1009869716 6:69438655-69438677 GAGTAGGTCCAGTTGGAGGTAGG - Intergenic
1013296414 6:108761809-108761831 GGGTAGGCACAGATGGAGGTGGG - Intergenic
1018478010 6:164162028-164162050 GATTTGGAAAACTTGGAGGTAGG + Intergenic
1019374850 7:683918-683940 GCATTGGCACACATGGAGGTGGG - Intronic
1020066877 7:5195089-5195111 CACCAGGCACAGTTGAAGGTGGG + Intronic
1022554174 7:31275366-31275388 GTCTAGGCCCCCTTGGAGCTGGG - Intergenic
1027926766 7:84475081-84475103 GACCCGGCACTCTTGGGGGTTGG - Intronic
1033407996 7:141089297-141089319 GGACAGGCAGACTTGGAGGTAGG + Intronic
1035353844 7:158265457-158265479 GACGGGACACACCTGGAGGTAGG + Intronic
1036165779 8:6431951-6431973 GACTTTGCACACTTGGATGTAGG - Intronic
1037884935 8:22590904-22590926 GACAGGGCACACCTGGAGATTGG + Intronic
1039816479 8:41099212-41099234 GACTTGGCATACATGGAGGGAGG + Intergenic
1040689121 8:49912722-49912744 GTGTAGGTATACTTGGAGGTTGG - Intronic
1042185324 8:66131000-66131022 GACTAGCCACAGTTGGGAGTGGG + Intronic
1045023962 8:98068655-98068677 GGCTAGGAACACTGGGAGGAGGG - Intronic
1045264130 8:100604554-100604576 GACTAGCCCCACCTGGAGGATGG + Intronic
1046130564 8:109962815-109962837 TAATAGGCACAGATGGAGGTAGG + Intergenic
1047737638 8:127780643-127780665 GCCTTGGCACTCCTGGAGGTAGG - Intergenic
1049792638 8:144479023-144479045 GACTAGACACACTTTGAGAAAGG - Intronic
1053417795 9:37957648-37957670 TACTAGGCACACTTCAAGGCTGG + Intronic
1060032470 9:120227230-120227252 GGCTAGGCTCACTTGAAGGCTGG - Intergenic
1060121402 9:120993871-120993893 GAGTGGGTACACTTGGAGGAAGG + Intronic
1060300156 9:122370410-122370432 AACTAGGCTCTCTTGGAGTTTGG + Intergenic
1062404021 9:136385702-136385724 AACTAGCCACACATGGTGGTGGG - Intronic
1190039514 X:47058580-47058602 GATTTGGCAAACTTGGAGTTAGG - Exonic
1192577705 X:72255962-72255984 TACTGGGCACCTTTGGAGGTGGG + Intronic
1195152062 X:102082180-102082202 GACAGGGCACATTTGGAAGTTGG - Intergenic
1196108240 X:111918733-111918755 GAGTAGGCAAACTGGGAGGATGG + Intronic
1197705144 X:129629588-129629610 GACTAGAAACACTTAGAGATTGG - Intergenic
1199122788 X:144076702-144076724 GATTAGGCACACTTAGGGGATGG + Intergenic
1202189175 Y:22223436-22223458 AATTAGCCACACTTGGTGGTGGG + Intergenic