ID: 1114636501

View in Genome Browser
Species Human (GRCh38)
Location 14:24190056-24190078
Sequence ATTCTTTGCCTGGCACAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114636496_1114636501 23 Left 1114636496 14:24190010-24190032 CCCTAATAGATTGAGGGCAGGGA 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1114636501 14:24190056-24190078 ATTCTTTGCCTGGCACAAAGAGG 0: 1
1: 0
2: 2
3: 19
4: 233
1114636497_1114636501 22 Left 1114636497 14:24190011-24190033 CCTAATAGATTGAGGGCAGGGAT 0: 1
1: 0
2: 1
3: 10
4: 139
Right 1114636501 14:24190056-24190078 ATTCTTTGCCTGGCACAAAGAGG 0: 1
1: 0
2: 2
3: 19
4: 233
1114636498_1114636501 -6 Left 1114636498 14:24190039-24190061 CCATTTTATTCCACTTTATTCTT 0: 1
1: 0
2: 22
3: 159
4: 1669
Right 1114636501 14:24190056-24190078 ATTCTTTGCCTGGCACAAAGAGG 0: 1
1: 0
2: 2
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114636501 Original CRISPR ATTCTTTGCCTGGCACAAAG AGG Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
902758865 1:18567620-18567642 ATGCTTGGCCTGGCACAGGGAGG - Intergenic
903919524 1:26789341-26789363 ACTCTTTCCTTGGCACAAGGGGG - Intronic
904238196 1:29127462-29127484 GTTGAGTGCCTGGCACAAAGTGG + Intergenic
904376293 1:30084478-30084500 ATTCTTTGCCAGACACTCAGAGG - Intergenic
904585811 1:31579899-31579921 CCTCTTTGCCTGGGACTAAGAGG + Intronic
904966785 1:34380328-34380350 GTTCAGTGTCTGGCACAAAGCGG + Intergenic
905170129 1:36105015-36105037 CATCTTTGCCTGGCAACAAGTGG + Intronic
905401929 1:37710000-37710022 TTTCTTGGCCAGGAACAAAGCGG + Intergenic
906090637 1:43176587-43176609 ATTTTGTGCCTGGAACACAGGGG - Intronic
906356807 1:45114264-45114286 CTAGTTTGCCTGGTACAAAGTGG + Intronic
906365697 1:45207356-45207378 ATCCTCTGCCTGGCACATAGTGG + Intronic
908261780 1:62344719-62344741 AAGCTCTGCCTGGCACATAGTGG - Intergenic
908432252 1:64070718-64070740 AGCCTTGGCCTGGCACACAGTGG - Intronic
908502210 1:64755029-64755051 GTTCTGTGCCTGGCCCAGAGTGG + Intronic
908757430 1:67481729-67481751 TATCTTTGCCTGGCACATCGAGG - Intergenic
911698839 1:100926750-100926772 GCTATTTGCCTGGCACAGAGTGG - Intronic
912029559 1:105222612-105222634 ATTCTTTAGTTGGCACAAAATGG + Intergenic
915274294 1:154777318-154777340 AGACGTTGCCTGGCACAGAGTGG + Intronic
916458810 1:164999318-164999340 TTCCTATGACTGGCACAAAGAGG + Intergenic
919795382 1:201318573-201318595 ATCCTGAGCCTGGCACAAATTGG + Intronic
920442774 1:205992412-205992434 ACACTGTGCCTGGCACATAGTGG + Intronic
921053850 1:211529474-211529496 AGTGTTTGCTTGGCACACAGTGG + Intergenic
923422052 1:233825786-233825808 ATTCTATGCGAGGTACAAAGAGG + Intergenic
924691295 1:246353802-246353824 ATACAGTGCCTGGCACACAGTGG + Intronic
1062880296 10:972991-973013 ATTCTGTGGGTGGGACAAAGAGG + Intergenic
1069552227 10:69372494-69372516 CGTCTTTCCCTGCCACAAAGAGG - Intronic
1071218012 10:83430149-83430171 CTTCTCTTCCTGGTACAAAGTGG + Intergenic
1073023230 10:100464956-100464978 TTTCTCTGCATGGCATAAAGGGG - Intronic
1073489702 10:103844822-103844844 ATGCAATGCCTGGCACAAAATGG + Intronic
1074616358 10:115072795-115072817 CTTCTCTTCCTGGCACAAGGAGG + Intergenic
1077677956 11:4214266-4214288 TTTCTTTGGCTGGCTGAAAGAGG - Intergenic
1078969548 11:16391490-16391512 ACTATATGCCAGGCACAAAGAGG - Intronic
1079395031 11:20054760-20054782 ATGCTTTGACTGGCACAGTGGGG + Intronic
1082613537 11:55331875-55331897 ATTCTATGCGAGGTACAAAGAGG - Intergenic
1083363698 11:62128752-62128774 ATTCTCTGTTTGGCACAAGGAGG - Exonic
1083825006 11:65196120-65196142 ATTCTTTACCTGGCCTAAACAGG - Intronic
1083921813 11:65785422-65785444 CAGCTGTGCCTGGCACAAAGTGG - Intergenic
1084645565 11:70455444-70455466 TTTCTTGCCCTGGCACAGAGAGG + Intergenic
1084995152 11:72969524-72969546 TTTGTGTGCCTTGCACAAAGTGG + Intronic
1085294788 11:75425324-75425346 ATTCTGCGCCTGGCACACAGTGG + Intronic
1086182666 11:83972811-83972833 ATCCTGTGCCTGGCACAGAGTGG - Intronic
1086249466 11:84795993-84796015 ATTCTGTGCCTGGCTCAACCTGG + Intronic
1086503471 11:87477908-87477930 ATTCTTAGCTTTGGACAAAGCGG - Intergenic
1086897901 11:92334701-92334723 ATTCTTTCCCTGGTAGAATGTGG + Intergenic
1088584392 11:111348144-111348166 ATTCTTTTTATGGCACAAAAGGG - Intergenic
1089387022 11:118075085-118075107 ATGTTTAGCCTGGCACATAGAGG + Intergenic
1090428732 11:126628641-126628663 ATTCTCTGCTGGGGACAAAGAGG - Intronic
1091514145 12:1161123-1161145 TGTCTTTGCCTAGCACATAGTGG - Intronic
1092817853 12:12326772-12326794 ACTCTTAGCCAGGCACATAGTGG - Exonic
1092921517 12:13235943-13235965 ATTACTTGCCTGGCTCAGAGAGG + Intergenic
1099086996 12:78257932-78257954 ATCCTGTGCCTGGCTCAGAGGGG - Intergenic
1100153545 12:91770691-91770713 ATGATTTGCCTTGGACAAAGTGG + Intergenic
1100775955 12:97974756-97974778 TTTCTTTGGCTGGCATAATGGGG - Intergenic
1101397344 12:104359949-104359971 ATAGTGTGGCTGGCACAAAGGGG + Intergenic
1104657222 12:130582270-130582292 TTTCTGTGCCTGGTACATAGTGG + Intronic
1106581938 13:31026304-31026326 CCTCTTTGCTGGGCACAAAGAGG - Intergenic
1107739905 13:43438675-43438697 GTTGTATGCCTGGCACACAGTGG + Intronic
1112684109 13:101803048-101803070 ATTCTTTGCTCTGGACAAAGGGG + Intronic
1112761444 13:102697473-102697495 ATCCTTTGCCTGGCCCAGGGTGG - Intergenic
1113313477 13:109154982-109155004 ATTCTGTCCCTGCCATAAAGGGG - Intronic
1114636501 14:24190056-24190078 ATTCTTTGCCTGGCACAAAGAGG + Intronic
1116789062 14:49320136-49320158 ATTCTCAGCCTCCCACAAAGTGG - Intergenic
1117747720 14:58887931-58887953 TTTAATTGCCTGTCACAAAGGGG - Intergenic
1118729992 14:68659355-68659377 TTTCTTTGCTTGGCTTAAAGGGG - Intronic
1120444073 14:84571499-84571521 ATTCTTTGCCTGGAATCTAGTGG + Intergenic
1122123172 14:99565367-99565389 ATGCAATGCCTGGCACAATGTGG + Intronic
1123453805 15:20397363-20397385 ATGCTTAGCCTGGCAAAAATTGG - Intergenic
1124427333 15:29572699-29572721 CTTCAGTGCCTGGCACATAGTGG - Intergenic
1125612398 15:40980325-40980347 ATTATTTCCCTTGCTCAAAGGGG + Exonic
1126238031 15:46408359-46408381 ATACAATGCCTGGCACATAGTGG + Intergenic
1127002842 15:54530405-54530427 ATGCCATGCTTGGCACAAAGAGG - Intronic
1127850545 15:62908293-62908315 TTTGTTTGCCTGGCAGAAATAGG - Intergenic
1128321512 15:66698015-66698037 ATTCAATGCCTGTCACATAGTGG - Intergenic
1128933804 15:71728416-71728438 GATCATTGCCTGGCACATAGTGG + Intronic
1130369093 15:83268348-83268370 CTTCTGGGCCTGGCACACAGTGG - Intronic
1130723683 15:86415991-86416013 TTTCTTAGCCTTGGACAAAGAGG + Intronic
1131466157 15:92656116-92656138 ATTCTTAGTCTGACACAATGTGG - Intronic
1131969492 15:97877248-97877270 ATGGTTTGCCTGGCACTGAGCGG - Intergenic
1132261562 15:100429593-100429615 TTCTTTTGCCTGGTACAAAGGGG - Intronic
1133857877 16:9566478-9566500 ATTCTCAGGCTGTCACAAAGTGG - Intergenic
1134441036 16:14299852-14299874 GCTCTGTGCCTGGCACACAGAGG + Intergenic
1134687884 16:16171485-16171507 AGACTTAGCCTGGCACATAGTGG + Intronic
1137018773 16:35401620-35401642 ATTCCATGCCTGCCTCAAAGAGG - Intergenic
1138124160 16:54425127-54425149 TTTCTTAACCTGGCACCAAGAGG - Intergenic
1138593651 16:58017426-58017448 ATTCATTACCTGGTAGAAAGTGG - Exonic
1138700037 16:58852986-58853008 TTTGTTTTCATGGCACAAAGTGG - Intergenic
1139973885 16:70793566-70793588 ATCATGTGCCTGGCACACAGTGG - Intronic
1141770947 16:86089361-86089383 ATACATGGCCTGGCACACAGTGG - Intergenic
1145012086 17:19374372-19374394 ATTATTTGCCTGTCAAAAATGGG - Intronic
1148163265 17:45463979-45464001 TTCCTTTGCCTGGCATAATGAGG - Intronic
1148408291 17:47440415-47440437 ATGCTTTGCCTTACAGAAAGTGG + Exonic
1148476291 17:47930900-47930922 ATTCCATGCCTGGAAGAAAGAGG + Intergenic
1148987681 17:51637852-51637874 ACACTGTGCCTAGCACAAAGAGG - Intronic
1149522802 17:57330880-57330902 ATTCCTGGCCTTGCCCAAAGAGG + Intronic
1150394497 17:64810631-64810653 TTCCTTTGCCTGGCATAATGAGG - Intergenic
1151056033 17:71032525-71032547 CTTCTTTGCCTGCCACAGTGTGG + Intergenic
1152089818 17:78240247-78240269 ACTCCTTGCCTGCCTCAAAGGGG + Exonic
1155026258 18:21943523-21943545 ATACATTGCCTGACACACAGCGG + Intergenic
1156508865 18:37618116-37618138 TTTGTGTGCCTGGCACAGAGTGG - Intergenic
1156941564 18:42773106-42773128 AGTCTTTGCCTTGCACAGAAGGG - Intronic
1157727680 18:49977531-49977553 ATTCTGTGCCTGGCACTGTGAGG + Intronic
1160355447 18:78224467-78224489 ATTCCTTGCCTGCCATGAAGAGG + Intergenic
1161625055 19:5321589-5321611 ACTCTGGGCCTGGCACACAGTGG - Intronic
1163528040 19:17833096-17833118 TTCCTTTGCCTGGGACAGAGTGG - Intronic
1164144274 19:22501338-22501360 TTTTTTTGCCTGGCAAAAAAAGG - Intronic
1165410715 19:35659233-35659255 ACTCATTGACTGGCACAGAGAGG - Intergenic
1166222290 19:41373466-41373488 AAACAGTGCCTGGCACAAAGTGG - Intronic
1166289397 19:41852357-41852379 TGTCTATGCCTGGCACAGAGCGG - Intergenic
926481484 2:13401871-13401893 ATGCTTAGCCTGGCAAAAATTGG + Intergenic
926918833 2:17919061-17919083 ATTCTTTGCTTTTTACAAAGAGG + Intronic
928425742 2:31176379-31176401 CATATGTGCCTGGCACAAAGTGG + Intronic
929601313 2:43206457-43206479 ACACCTTGCCTGGCACACAGTGG - Intergenic
930832900 2:55764181-55764203 ATACCTTGCCTGGCCAAAAGTGG - Intergenic
932180069 2:69638934-69638956 ATACAGTGCCTGCCACAAAGAGG + Intronic
932711066 2:74063338-74063360 ATTATTTGCTGGACACAAAGGGG - Intronic
932916577 2:75865666-75865688 ATTCTATGGATGGCACCAAGGGG + Intergenic
941990987 2:171556738-171556760 GCCCTCTGCCTGGCACAAAGTGG + Exonic
942070200 2:172309219-172309241 ATCCTGTGCCTGGCACACATAGG + Intergenic
944193638 2:197029266-197029288 ATTCTTGGCCTGGCAAAGAATGG + Intronic
945728360 2:213501722-213501744 ATTCTCTGCCAAGCACAAAAAGG - Intronic
948353345 2:237358774-237358796 CTCCAGTGCCTGGCACAAAGTGG - Intronic
1170261781 20:14416702-14416724 CTTTATTGCCTGGCACATAGTGG - Intronic
1171460569 20:25295762-25295784 ATTCTTGGCCTGGGCCAGAGGGG + Intronic
1172834008 20:37861182-37861204 AGTCTGTACCTGGCACACAGCGG + Intronic
1173159484 20:40641785-40641807 AGCCTGTGCCTGGCACAGAGTGG - Intergenic
1173419900 20:42891762-42891784 ATACAGTGCCTGGCACACAGTGG - Intronic
1174830620 20:53808885-53808907 GTTCAGTGCCTGGCACAGAGTGG + Intergenic
1177856600 21:26406852-26406874 ATTATTTGCCTGTCTCAGAGAGG - Intergenic
1182327117 22:29521824-29521846 ATTCTTTCCCTGAACCAAAGGGG + Intronic
1182827319 22:33277086-33277108 AGGCTTTGGCTGGAACAAAGTGG - Exonic
1183260427 22:36791490-36791512 ATACGCTCCCTGGCACAAAGGGG - Intergenic
1183572888 22:38667459-38667481 ATTTTTTGGGTGGCACACAGTGG - Intronic
1184277669 22:43419481-43419503 AGGCTTTCCCTGGCACAGAGGGG - Intronic
950753765 3:15155158-15155180 AGCCTTTACATGGCACAAAGTGG + Intergenic
951349100 3:21583216-21583238 ACTCTTTTCATGGCCCAAAGGGG + Intronic
953390071 3:42528692-42528714 ATTCATTGCCAGTCACTAAGGGG + Intronic
954932321 3:54295038-54295060 AGCCTTTGACTGGCACAAAATGG - Intronic
956515925 3:70047784-70047806 TGTCTTTGCATGGCAGAAAGCGG + Intergenic
956982714 3:74657477-74657499 ATTCTTTGTGTGGCAAAAGGAGG + Intergenic
957566610 3:81892220-81892242 ATGTTGTGCCTGGCACAAGGTGG - Intergenic
958634671 3:96728287-96728309 ATGCTTTGGCTGTCACAGAGTGG - Intergenic
958896395 3:99834515-99834537 ATGCTTGGTCTGACACAAAGTGG - Intronic
963575802 3:147059552-147059574 ATACTTTCCCTGCCCCAAAGTGG + Intergenic
963717303 3:148818391-148818413 CTTCTCTTCCTGGAACAAAGCGG + Intronic
966258018 3:177941408-177941430 ATACTTTCCCTGACATAAAGGGG - Intergenic
966738224 3:183207321-183207343 CCTCTTTGCCTGGAAGAAAGAGG + Intronic
966784708 3:183612582-183612604 GCTCTGTGCCTGGCACATAGTGG - Intergenic
967050741 3:185782194-185782216 ATTAAGTTCCTGGCACAAAGAGG - Intronic
968799464 4:2732726-2732748 CTGCTCTGCCTGGCACACAGAGG - Intergenic
970381761 4:15515325-15515347 CATCTGTGCCTGGCACAAGGAGG + Intronic
970781123 4:19739323-19739345 CCTCTTTACCTTGCACAAAGTGG - Intergenic
970931109 4:21513088-21513110 TTTCTCTGCCTGGAACATAGTGG - Intronic
973589847 4:52429926-52429948 ATTCTTTTCCTGGCATTAACTGG - Intergenic
974112375 4:57540395-57540417 ATACTTTGTCTTGCACAAAGAGG - Intergenic
974514855 4:62896725-62896747 ATTTATTGTCTGGCACAAAAGGG + Intergenic
975371317 4:73591822-73591844 ACTGTGTGCCTGGCACAAAGAGG - Intronic
975641669 4:76506535-76506557 TATCTTAGCCTGGCACATAGTGG + Intronic
976401068 4:84607993-84608015 ATTATTTGTATGGCACAATGGGG + Intronic
977649800 4:99456278-99456300 ATACTGTGCCTTGTACAAAGTGG + Intergenic
978262431 4:106776012-106776034 AATCTTTTCCTGACACAAGGGGG - Intergenic
979085362 4:116403093-116403115 ATAATTTGCCTGGTACAAAATGG + Intergenic
979615039 4:122732966-122732988 ATTCTTTCCCTGGCCCGAAGAGG - Intronic
981582093 4:146260321-146260343 ATTCATTCCTTGGCCCAAAGAGG + Intronic
981695018 4:147551284-147551306 TTTCTTTGTATGGCACAAATAGG - Intergenic
981912655 4:149999646-149999668 TTTCTCTGCCTGGCAGAAGGTGG + Intergenic
987131137 5:14861236-14861258 ATTCTGTGCATGTCCCAAAGAGG - Intronic
987360981 5:17106255-17106277 ATACTCTGCTTGGCACAATGTGG + Intronic
989616420 5:43341107-43341129 ATCCTGTGCCTGGCTCAGAGGGG + Intergenic
990334441 5:54758162-54758184 CTTCTGTGCCTGGCACAAGATGG + Intergenic
991805127 5:70417067-70417089 ATTCTTGGCAGGGCACACAGTGG - Intergenic
991866257 5:71065955-71065977 ATTCTTGGCAGGGCACACAGTGG + Intronic
992619465 5:78578362-78578384 ATCCTTTAACTGGCAAAAAGTGG - Intronic
993274078 5:85834249-85834271 TTTCTTTGCCTGGCAGGAAGAGG + Intergenic
995697570 5:114897723-114897745 ATTCTGTGCCTGAAAGAAAGAGG - Intergenic
996197204 5:120623367-120623389 ACTGATTGCCTAGCACAAAGTGG + Intronic
997213534 5:132092392-132092414 GTTATTGGCCTAGCACAAAGAGG + Intergenic
997408855 5:133674705-133674727 ATACCATGCCTGGCACACAGTGG + Intergenic
998540535 5:142977377-142977399 ATTCTTTTATTGGCACACAGAGG + Intronic
999144668 5:149384345-149384367 ATTGTTTGCCTGGCACATAATGG + Intronic
1000048311 5:157540124-157540146 ATGCCATGCCTGGCACAAAGTGG + Intronic
1000251305 5:159498067-159498089 GCTCCTTGCCTGGCACAAAGAGG - Intergenic
1001117004 5:168948224-168948246 ATGCACTGCCTGGCACACAGTGG + Intronic
1001557385 5:172646082-172646104 TTTCTTTCCCTGGGACACAGCGG + Intronic
1002878163 6:1229365-1229387 GTTCAGTGCCTGGCACATAGTGG - Intergenic
1002920843 6:1572067-1572089 GATTTTTGCCTGGCAGAAAGTGG - Intergenic
1003179249 6:3777957-3777979 ATTCTGTGCGTAGAACAAAGCGG - Intergenic
1004477948 6:15991418-15991440 TCTCTTTGCCTGGCACATAGTGG + Intergenic
1008974229 6:57405726-57405748 TGTTTTTGCCTGGCACATAGTGG - Intronic
1009163119 6:60307249-60307271 TGTTTTTGCCTGGCACATAGTGG - Intergenic
1009927811 6:70141332-70141354 ATTCTGTTAATGGCACAAAGTGG + Intronic
1009966890 6:70587337-70587359 ATTATTAGCCAGGCACATAGTGG + Intronic
1011418546 6:87148688-87148710 GTTCAATGCCTGGCACATAGTGG - Intergenic
1012425591 6:99110793-99110815 ATGCATGGCCTGGCACATAGGGG + Intergenic
1013161824 6:107552530-107552552 ATTCTGAGCCTGGACCAAAGGGG + Intronic
1014229080 6:118882111-118882133 ATTCTTTGCCTGTCACACCTAGG - Intronic
1014810146 6:125875972-125875994 ATCCTAGGCTTGGCACAAAGTGG + Intronic
1015119276 6:129683763-129683785 TATCTCTGCCTTGCACAAAGTGG + Intronic
1015428532 6:133102015-133102037 CTCCTTTGCCTGTCATAAAGTGG - Intergenic
1017891962 6:158646086-158646108 ATTATGTGCCAGGCACAATGTGG - Intergenic
1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG + Intergenic
1018921830 6:168180870-168180892 AGCCTGTGCCTGGGACAAAGCGG + Intergenic
1019569036 7:1700229-1700251 ATTCTTTCCCTGGCTCAGATGGG - Intronic
1019867604 7:3727473-3727495 ATTCTCTCCCTGGCAAAAAGAGG - Intronic
1021258076 7:18419436-18419458 AGTCTTTGCCTGACTCAAACGGG - Intronic
1022062759 7:26816151-26816173 ATTCTTTATATAGCACAAAGTGG - Intronic
1022583329 7:31579409-31579431 TTTCTGTGCCTGCCACATAGAGG - Intronic
1023571034 7:41572082-41572104 TTTCTTCCCATGGCACAAAGGGG - Intergenic
1024193396 7:47035076-47035098 GTTCAGTGCCTGGCACATAGAGG - Intergenic
1026509629 7:71017261-71017283 TTTATTTGCCTTTCACAAAGTGG - Intergenic
1028582432 7:92421926-92421948 ATTCACTGCCTGTCACAAGGTGG - Intergenic
1029676310 7:102071511-102071533 ATTCTTTGCTTGGCAGAAAAAGG - Intronic
1029678665 7:102092060-102092082 ATTCTTTTCCTGTCAAGAAGTGG - Intronic
1029934219 7:104406430-104406452 ATTAATTTCCTGGCACATAGTGG - Intronic
1030406972 7:109127369-109127391 CTTCTTTTCCTGGTACAGAGAGG + Intergenic
1030815501 7:114031571-114031593 TGTCTTTACATGGCACAAAGAGG - Intronic
1039400929 8:37268723-37268745 ATTCTTTGCGTGGCACATGTTGG + Intergenic
1040871083 8:52100708-52100730 ATGCTTCGCCTGGCACACTGAGG - Intergenic
1042572667 8:70183856-70183878 ATTTGCTGCCTGGCACATAGTGG + Intronic
1044408287 8:91855813-91855835 ACTCTATGCCTAGCACAAAGAGG - Intergenic
1044903900 8:96978923-96978945 ATTATTTGCCTGACATGAAGTGG - Intronic
1045046269 8:98282019-98282041 TTACCTTGCCTGGCAGAAAGAGG - Intronic
1045764703 8:105653345-105653367 ATTCTCTACCTGGCATATAGTGG - Intronic
1045906855 8:107355944-107355966 TTTCACTGCCTGGCACATAGTGG + Intronic
1047534850 8:125710075-125710097 ACCCTGTGCCTGGCACATAGTGG + Intergenic
1047785518 8:128150557-128150579 ATTGTTTGCCTTGTAGAAAGTGG - Intergenic
1048317110 8:133370504-133370526 CGTCTTTGCCTGGCACCCAGGGG - Intergenic
1048868983 8:138781746-138781768 ATCCTTTGATTGGCACCAAGTGG - Intronic
1051671918 9:19519174-19519196 AATCTATGCCTGGCATAGAGAGG - Intronic
1052258760 9:26490961-26490983 CTTCTTCGCCTGGGACACAGTGG + Intergenic
1052324410 9:27202011-27202033 ATTCTTTTCCTGGATCAAATAGG + Intronic
1055833360 9:80409264-80409286 CTTCTCTGCCTGATACAAAGAGG - Intergenic
1056067459 9:82951726-82951748 ATTTGTATCCTGGCACAAAGGGG - Intergenic
1057181248 9:93031849-93031871 ATCCTTTTCCCAGCACAAAGAGG - Intronic
1057722542 9:97544602-97544624 ACTGTATGCCTGGCACATAGAGG - Intronic
1058092961 9:100826334-100826356 ATTCTATCAGTGGCACAAAGAGG - Intergenic
1059543890 9:115157236-115157258 ATACTGTGCCTGGCCCAAAGTGG - Intronic
1059847628 9:118298572-118298594 ATTCATTTTTTGGCACAAAGCGG + Intergenic
1060039867 9:120290817-120290839 TGTCTGTGCCTGGCACAGAGTGG + Intergenic
1185989099 X:4873071-4873093 ACTATTTGACTGGGACAAAGCGG - Intergenic
1187208433 X:17205184-17205206 ATTCTTTCCCTGAAGCAAAGAGG - Intergenic
1189228256 X:39431764-39431786 AATCTTTGCCAGGCCCAAAGAGG + Intergenic
1189337620 X:40179855-40179877 GTACAGTGCCTGGCACAAAGTGG - Intergenic
1191895387 X:65987184-65987206 ATACTCTGCCTGGCACACAAAGG - Intergenic
1193557250 X:82970177-82970199 ATTTGTTGCCAGGCACAAAAAGG + Intergenic
1193674227 X:84428777-84428799 AATCTTTGCCTAGCCAAAAGTGG + Intronic
1195430794 X:104787090-104787112 AAACGTTGCCTGGCACAAAGTGG - Intronic
1196575306 X:117310577-117310599 ATTATTTGGCTGTCAAAAAGGGG + Intergenic
1196768596 X:119271949-119271971 ACTCTTTGGCTGGAACAAAATGG + Intergenic
1197526603 X:127571944-127571966 TTTCTTTGCCAGGCTCAAATTGG + Intergenic
1198150152 X:133900309-133900331 ATTGATTGCCTGGCACATAGAGG + Intronic
1198926847 X:141807206-141807228 TTTCTTTGCATGGCACAAAGTGG - Intergenic
1199244224 X:145583900-145583922 ATATATTGCCTGGCACTAAGTGG + Intergenic
1199418565 X:147616022-147616044 ATGCTGTGCCTGGCACAAAGTGG + Intergenic
1199784276 X:151090449-151090471 ATACAGTGCCTGGCACAGAGTGG + Intergenic