ID: 1114636873

View in Genome Browser
Species Human (GRCh38)
Location 14:24192535-24192557
Sequence TATCCAGAGGGGCAGACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114636873 Original CRISPR TATCCAGAGGGGCAGACCTA AGG (reversed) Intronic
900106128 1:981872-981894 GGTCCAGAGGGGCTGACCTGAGG - Intronic
901845519 1:11979957-11979979 TCTCTAGAGGGCCAGGCCTAGGG - Intergenic
902612062 1:17603239-17603261 TAGCCAGATGGGCAGGCCTGCGG + Intronic
908395613 1:63722764-63722786 TCTCTAGAGGGACAGAACTAAGG + Intergenic
909857719 1:80560241-80560263 TATGAAGAGGGGAAAACCTAAGG - Intergenic
912865340 1:113251308-113251330 TATGAAGAGAAGCAGACCTAGGG - Intergenic
917302997 1:173598153-173598175 TATCTACAAGGGCAGTCCTAAGG + Intronic
920398693 1:205663840-205663862 TATTCAAAGGCGCAGACCTAGGG + Intronic
923369245 1:233294394-233294416 TATCCAAAGGGTCAGAACTCTGG - Intronic
1064069828 10:12218621-12218643 TCTCCAGAGGCGCAGCACTAAGG - Intronic
1065839221 10:29687067-29687089 TATCCAGAGGAGAAGGCCTCAGG + Intronic
1071477051 10:86033934-86033956 TTTCCATAGGGGCAGCCCCAGGG - Intronic
1071769651 10:88712892-88712914 TAACCAGAGGGTCAGATATAAGG + Intergenic
1088157635 11:106827991-106828013 TATCCAGAGAATCCGACCTACGG + Intronic
1091417684 12:303507-303529 TGTCCAGGGGTGCAGGCCTAGGG + Intronic
1100038019 12:90277289-90277311 TAAACAGAGGTGCAGATCTAAGG + Intergenic
1100213092 12:92418491-92418513 CATCTAGATGGGCAGACGTAGGG - Intergenic
1102073072 12:110037684-110037706 TATGCAGAGGTGCAGAACCAGGG + Exonic
1107540209 13:41382307-41382329 TATAGAGAGGGGCTGACCTAAGG - Intergenic
1114636873 14:24192535-24192557 TATCCAGAGGGGCAGACCTAAGG - Intronic
1119060167 14:71465719-71465741 TCTCTAGAGGGACAGAACTAAGG + Intronic
1121337035 14:93083798-93083820 TCTCCAGAGGAGCTGACCTGGGG - Intronic
1121529423 14:94641804-94641826 TATACAGAGCAGCAGACCCAGGG + Intergenic
1122334018 14:100954967-100954989 TCTACAGAGGGGCAGACATGGGG - Intergenic
1122814055 14:104303688-104303710 GATCCAGAGGGGCACCCCTAAGG - Intergenic
1123467878 15:20529622-20529644 TATGCAGAGGGGCAGAACGGAGG + Intergenic
1123650234 15:22471420-22471442 TATGCAGAGGGGCAGAACGGAGG - Intergenic
1123728193 15:23124831-23124853 TATGCAGAGGGGCAGAACGGAGG + Intergenic
1123740640 15:23280262-23280284 TATGCAGAGGGGCAGAACGGAGG - Intergenic
1123746358 15:23322296-23322318 TATGCAGAGGGGCAGAACGGAGG + Intergenic
1124278625 15:28345613-28345635 TATGCAGAGGGGCAGAACGGAGG + Intergenic
1124304075 15:28565995-28566017 TATGCAGAGGGGCAGAACGGAGG - Intergenic
1124532957 15:30522467-30522489 TATGCAGAGGGGCAGATCGGAGG - Intergenic
1124765700 15:32485177-32485199 TATGCAGAGGGGCAGATCGGAGG + Intergenic
1125330338 15:38575620-38575642 TCTCCAGAGCAGCAGACCTGTGG - Intergenic
1129826284 15:78637191-78637213 TATGCAGAGGGGCAGATTTGAGG - Intronic
1130156073 15:81351206-81351228 GAGCCAGAGGGGCAGCACTAAGG - Intronic
1131823528 15:96296854-96296876 TTCCCAGAGGGGCAGAATTAAGG - Intergenic
1132484478 16:183344-183366 TACCCAGAGGTGCAGATCCAAGG + Intergenic
1136247553 16:28984481-28984503 TCTCCACAGGGGCAGCCCCAAGG + Exonic
1138008569 16:53358326-53358348 TATGCAAAGGGGCAGATCTGAGG + Intergenic
1138658973 16:58506864-58506886 CATGCAGAGGGGCAGACAGAGGG - Intronic
1142553386 17:754333-754355 TATCCAGAAAGGCAGGTCTACGG + Intergenic
1143037377 17:4007181-4007203 TGCCCAGAGGGGCAGTCCCAGGG + Intronic
1146577396 17:34006741-34006763 TATCAAAAGGGGCTGACCCATGG + Intronic
1151190710 17:72395821-72395843 CATCCAGAAGGCCAGACCCACGG + Intergenic
1151219036 17:72598140-72598162 AATCCACAGGTGCAGAACTATGG - Intergenic
1151955508 17:77378251-77378273 CATCCAGAGGGGCAGTGCTTTGG + Intronic
1152240102 17:79156518-79156540 TCTCCAGTTGGGCAGGCCTAGGG + Intronic
1155148769 18:23105851-23105873 TTTCCTGAGGCGCAGACCTTAGG + Intergenic
1156369934 18:36464384-36464406 TGTGCAGCGGGGCAGACCTCTGG + Intronic
1158228166 18:55222061-55222083 TATCCAAAGGGGCTGAAATAGGG - Intergenic
1162975245 19:14204589-14204611 GATCCAGTGGGGCACACCTGAGG - Intronic
1164861433 19:31565083-31565105 TATGAACAGGGGCAGACCTGCGG + Intergenic
1166186025 19:41139555-41139577 TTTGGAGATGGGCAGACCTAGGG - Intergenic
1166427775 19:42695016-42695038 TATCCAGAGTTGGAAACCTATGG - Intronic
931641342 2:64383274-64383296 TAGGCAGAGGGGCAGACCTGGGG + Intergenic
933395592 2:81727011-81727033 TATCTAGAGGGTAAGACTTATGG + Intergenic
933445248 2:82371566-82371588 TATCCAGAGGTGCAATTCTATGG + Intergenic
938897833 2:135769887-135769909 TATTCAGTGTGGCAGGCCTAGGG + Intronic
940316542 2:152333486-152333508 TATCCAGATGGGCAACCCTCTGG + Intergenic
942386734 2:175450771-175450793 CATCTACAGGGGCAGAGCTATGG + Intergenic
1170578815 20:17682673-17682695 TATCCAGAGGCGCAGGCCCGGGG - Intergenic
1172947524 20:38700840-38700862 TATTCACAGGGGCTGACCTTCGG - Intergenic
1173455904 20:43201106-43201128 TCTCCAGAGTGGCAAACTTAGGG + Intergenic
1174429984 20:50460716-50460738 TCCCCAGAGGGGCTGAGCTATGG + Intergenic
1174998353 20:55598427-55598449 TGTCCAGAGCGGCAGAACTAGGG - Intergenic
1176510914 21:7747031-7747053 TTTCCAGAGGGCCAGACCACTGG + Intronic
1178645027 21:34377560-34377582 TTTCCAGAGGGCCAGACCACTGG + Intronic
1178764243 21:35434262-35434284 TCTCCAGAGGGACAAAACTAAGG + Intronic
1181487113 22:23238466-23238488 TATCCTGGGGGGCTGAACTAGGG - Intronic
954982731 3:54760938-54760960 TCTCCAGAGCGACAGACCCACGG - Intronic
963432641 3:145229496-145229518 TCTCTAGAGGGACAGAACTATGG + Intergenic
968739803 4:2321798-2321820 TTTCCAGAGGGGCAGACGTTGGG - Intronic
976779500 4:88743075-88743097 TATCCAGATGTGAAGATCTAAGG + Intronic
979039119 4:115764356-115764378 TATCCAAAAGGGCAGAACTCTGG + Intergenic
983090003 4:163492366-163492388 TCTCCACAGGGCCAGACTTAGGG + Intergenic
986887714 5:12260508-12260530 TATCCATAGGAGCAGCTCTATGG + Intergenic
991369913 5:65907674-65907696 TATCCAAAGGGTCAGTCCAAGGG + Intergenic
996591907 5:125157833-125157855 TATTCAAAGGTGCAGAACTAGGG - Intergenic
998099382 5:139419406-139419428 CACCCAAAGGGGCAGACCCAAGG + Intronic
998896622 5:146806938-146806960 GACCCACAGGGGTAGACCTAAGG - Intronic
999263915 5:150254159-150254181 TATCTAGAGGGGAAGCCCTCAGG + Intronic
1028872743 7:95787004-95787026 TATACAGATGGGCAGAATTAAGG + Intronic
1034298208 7:149992722-149992744 TCTCCAGAGGGACAGATCTGTGG + Intergenic
1034807811 7:154104061-154104083 TCTCCAGAGGGACAGATCTGTGG - Intronic
1035034202 7:155884705-155884727 TATCAAGAGGGGCTGTCCTAAGG + Intergenic
1035524607 8:302588-302610 AAGCCAGAGGGGCAGTCCTGGGG - Intergenic
1041241768 8:55854453-55854475 TGTGCTGAGGGGCAGACCAAAGG - Intergenic
1044547551 8:93476532-93476554 TCTCTAGAGGGACAGAACTAAGG - Intergenic
1058587741 9:106528646-106528668 TCTCCAGAGAGGCAGAGATATGG - Intergenic
1060470376 9:123943281-123943303 TAGACAGAGGTGCAGACCTGGGG + Intergenic
1062592945 9:137282155-137282177 TATCAAAAGGTCCAGACCTAAGG + Exonic
1185969373 X:4644974-4644996 TCTCCAGAGAGACAGAACTAAGG - Intergenic
1187953624 X:24494247-24494269 TTCCCAGAGGGGCAGAGCTATGG + Intronic
1192210395 X:69124014-69124036 GATCCAGAGGGGCAGAAAGATGG + Intergenic
1193666384 X:84323833-84323855 TATCCTCAGGGTCTGACCTACGG + Intronic
1196263061 X:113608431-113608453 TCTCCAGAGGATCAGACCTGAGG + Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1198816178 X:140593295-140593317 TATGCAGGAGGGCACACCTATGG - Intergenic