ID: 1114637353

View in Genome Browser
Species Human (GRCh38)
Location 14:24195398-24195420
Sequence CTGCCTTTGGGCTCCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 398}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114637343_1114637353 1 Left 1114637343 14:24195374-24195396 CCAGCGGCCTTCGCGCCCCCGTA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1114637353 14:24195398-24195420 CTGCCTTTGGGCTCCTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 398
1114637342_1114637353 12 Left 1114637342 14:24195363-24195385 CCGAGGCGGCGCCAGCGGCCTTC 0: 1
1: 0
2: 4
3: 4
4: 101
Right 1114637353 14:24195398-24195420 CTGCCTTTGGGCTCCTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 398
1114637338_1114637353 30 Left 1114637338 14:24195345-24195367 CCGCGCGGGAAGGGCTGGCCGAG 0: 1
1: 0
2: 2
3: 8
4: 118
Right 1114637353 14:24195398-24195420 CTGCCTTTGGGCTCCTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 398
1114637344_1114637353 -6 Left 1114637344 14:24195381-24195403 CCTTCGCGCCCCCGTAGCTGCCT 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1114637353 14:24195398-24195420 CTGCCTTTGGGCTCCTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114637353 Original CRISPR CTGCCTTTGGGCTCCTGCTG GGG Intronic
900264162 1:1749066-1749088 CTGGGTCTGGGCTCCCGCTGGGG + Intergenic
900474794 1:2870980-2871002 CCGCCTTGGGGCCCCTGTTGGGG - Intergenic
900487683 1:2931183-2931205 CTGGCTTTGGGCTCCTGCACGGG + Intergenic
901422470 1:9160408-9160430 CTCCCATTGGGCTCCTCCCGGGG - Intergenic
901908318 1:12433676-12433698 TTGCCAATGGGCACCTGCTGGGG + Intronic
902238644 1:15073947-15073969 CTGCCCTTGGGCTCCTGAGGAGG + Intronic
902651761 1:17841976-17841998 CTTCCTTTGAGATCCTGCTTGGG + Intergenic
902767040 1:18623853-18623875 CTGCCTTGGGAGTCCTGGTGGGG - Intergenic
902820193 1:18938817-18938839 CTGCCTTTGAGGGCCTGCAGGGG - Intronic
903023830 1:20412967-20412989 CTGCCTTGGGGCTTCTGCACTGG - Intergenic
903049041 1:20587420-20587442 CAGCCTATTGCCTCCTGCTGGGG - Intergenic
903133853 1:21296704-21296726 CTGGGTTTGGGCTCCAGCTCTGG - Intronic
903344928 1:22677835-22677857 CTGCCTGAGGGCCCATGCTGGGG - Intergenic
904121358 1:28200197-28200219 CTCACTTTGGGCCCCTCCTGAGG + Intronic
904212237 1:28893640-28893662 CTGCCTCTGGGGTCTTGCTGGGG - Intronic
904489252 1:30848078-30848100 CTTCCTCAGGGCTCCAGCTGGGG - Intergenic
905362717 1:37431416-37431438 CAGCCTTTGGGCTGCCGCTGAGG - Intergenic
905453004 1:38068999-38069021 CTGCCTTTGGCCTCCAGGTTGGG - Intergenic
905615938 1:39398804-39398826 CTGCCACAAGGCTCCTGCTGTGG + Intronic
906507920 1:46393985-46394007 CTGGCATGGGGCTCCGGCTGGGG + Intergenic
907298575 1:53470992-53471014 CAGCCTTTGGCCACCTACTGCGG + Intergenic
908029077 1:59981079-59981101 CTGTCTCTGGGATCCTGATGAGG - Intergenic
911231196 1:95363256-95363278 CTGCCTTAATGTTCCTGCTGTGG + Intergenic
914672688 1:149883681-149883703 CTGGTTTTGGGCTCCACCTGGGG - Intronic
915895430 1:159808085-159808107 CAGCCTAAGGCCTCCTGCTGGGG - Intronic
915899940 1:159839732-159839754 GTGCCTTTGAGCTCATGCTAGGG - Intronic
916525728 1:165607219-165607241 GTGCCTTTGGTCTCCTGCCTCGG + Intergenic
917908757 1:179617690-179617712 CTGCTTTAGTTCTCCTGCTGTGG + Intronic
918071665 1:181137684-181137706 CTGGCTCTGGGCTCCTTCTGTGG + Intergenic
919055493 1:192565027-192565049 TTGCCTTTGGGCTCTTGCACTGG - Intergenic
919365813 1:196659534-196659556 CTGCCTCTGAGCTGCTACTGTGG - Intronic
919857310 1:201714599-201714621 CTTCACTTGGGCTCCTGCTGGGG - Intronic
920024841 1:202986732-202986754 CAGCTTTTGGGATCCTCCTGGGG + Intergenic
920305548 1:205016050-205016072 ATGCTTTTGGGCTCCTGTTCTGG - Intronic
921190012 1:212700194-212700216 CAGCCTTTGGGGTCCTTCGGCGG + Intergenic
921842969 1:219847694-219847716 CAGGCTTTGGGCTGGTGCTGGGG - Intronic
922143951 1:222919064-222919086 CTGGCTTATGGCTCCTACTGAGG - Intronic
923579616 1:235195739-235195761 CTGCCTTATGGCTCCTGGTTGGG + Intronic
1062833544 10:622134-622156 CTGCCCTGAGGCACCTGCTGGGG + Intronic
1063881539 10:10537444-10537466 CTCCATTTGGGCTCCTGCCCTGG - Intergenic
1065618256 10:27551139-27551161 CTGCCCCTGGGCTGCTGCTCTGG + Intergenic
1067265793 10:44743896-44743918 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1067348424 10:45455084-45455106 CTGCCTCTGCACCCCTGCTGTGG - Exonic
1067409271 10:46050549-46050571 CAGCCCTTGGGCTGATGCTGTGG + Intergenic
1067449851 10:46375645-46375667 CTGGCTTTGGGCGTCTCCTGTGG - Intronic
1067546383 10:47195394-47195416 CTGCCTTGCCGCTCCTCCTGAGG + Intergenic
1067587399 10:47484118-47484140 CTGGCTTTGGGCATCTCCTGTGG + Exonic
1067634454 10:47991885-47991907 CTGGCTTTGGGCGTCTCCTGTGG + Intergenic
1067975634 10:51022073-51022095 CTGACCTTGAGCTCCTGTTGGGG + Intronic
1068637372 10:59362611-59362633 GTGCCGCTGGGCCCCTGCTGGGG - Intronic
1068980704 10:63059663-63059685 TGGCCTTTGGCCTCCCGCTGTGG + Intergenic
1069679789 10:70275992-70276014 CTGAGTTTGAGCTCCTGCTTAGG + Intronic
1070464987 10:76712169-76712191 CAGGCTCTGGGCTCGTGCTGGGG - Intergenic
1070490072 10:76967742-76967764 TTGCCTTTGGGCTGCTGCTAAGG - Intronic
1070782599 10:79146363-79146385 CTGCCTTTGGTCTGTTGCTTGGG - Intronic
1070963899 10:80517854-80517876 CTGCCTTTGGGCCCCAGCAATGG + Intronic
1071390005 10:85163976-85163998 GTGACTTTGGGCTCTGGCTGTGG - Intergenic
1071601332 10:86959951-86959973 CTGCCTTGGGGCTGGGGCTGGGG + Intronic
1071676203 10:87658849-87658871 CTGCCTTTGGGTTCGTTCAGAGG + Intergenic
1071784781 10:88886983-88887005 CTGCCTTTGGGCTCATGCTTCGG + Intronic
1071962537 10:90821285-90821307 ATGCTTTGGGGCTGCTGCTGGGG - Intronic
1075395979 10:122127322-122127344 CCGCCTTGGGGCTCTTCCTGTGG + Intronic
1076314477 10:129531016-129531038 CTGGCTCTGGGCTCAGGCTGGGG + Intronic
1076727803 10:132421545-132421567 CCGCCCCTGGGCTCCAGCTGAGG + Intergenic
1077091334 11:779682-779704 CTGCCCTTGGGCTGATGCTATGG - Intronic
1077221764 11:1421084-1421106 CTGCCTGTGGGCTCCTGGCTTGG + Intronic
1077281236 11:1747185-1747207 CTGCCCTTGGGCTCCGGGTGAGG + Intronic
1077513023 11:2981488-2981510 CTGGGTTTGGGTTGCTGCTGTGG - Intronic
1077513346 11:2984232-2984254 CTGGGTTTGGGTTGCTGCTGTGG - Intronic
1080481655 11:32657594-32657616 CTGCCTTCTGGCTCCTGATTGGG + Intronic
1081534808 11:43988960-43988982 CTGCCTTTTGGCTGCGGGTGAGG - Intergenic
1082098103 11:48147746-48147768 CTGCCTTAGGGGTCCTCATGCGG + Intronic
1082916926 11:58447004-58447026 CTGGCTCTGGGCTGCTACTGGGG - Intergenic
1083322009 11:61853742-61853764 TTGCCATTCTGCTCCTGCTGGGG + Intronic
1084186149 11:67472912-67472934 CTGCCTCTGAGCAGCTGCTGGGG - Intergenic
1084558183 11:69887510-69887532 CTGCCTATGGCCTCCTGCTCTGG + Intergenic
1084641867 11:70430998-70431020 CTGCCCCTCGGATCCTGCTGGGG + Intronic
1084733698 11:71091201-71091223 CTGCCTGCGGGCTCCAGCTTGGG + Intronic
1085692621 11:78676152-78676174 CTGTCTTTGGGCGCCGGCTGCGG - Exonic
1087714683 11:101594566-101594588 CAGCCTCTGGGCTTCTGCTTAGG - Intronic
1088002708 11:104901643-104901665 CTGCTTGTGGTTTCCTGCTGGGG + Intergenic
1089130427 11:116207946-116207968 CAGCCTCTGGGATCCTGCGGAGG - Intergenic
1089584556 11:119502255-119502277 CAGCCTCGGGGCTGCTGCTGCGG + Intergenic
1090299834 11:125625972-125625994 CTGCATTTGGATTCCTGCAGTGG + Exonic
1090713836 11:129412532-129412554 CTGCCTTTGAGCTGCTGCTCTGG - Intronic
1093243948 12:16712378-16712400 CTCCCTTTTGGCACCTTCTGTGG - Intergenic
1093389662 12:18602714-18602736 CTGGCTTTGGGCTGGTACTGGGG - Intronic
1093508998 12:19903935-19903957 CTGCCTGTGTGTTCCCGCTGGGG - Intergenic
1095829874 12:46573374-46573396 GTGTCTTTGGGCTCTTGCAGGGG - Intergenic
1096386056 12:51196105-51196127 CAGGCTTTGGGCTGGTGCTGGGG + Exonic
1096582781 12:52599107-52599129 CTGCCTTTGGGTTCCAGGTGCGG - Exonic
1097878156 12:64662735-64662757 GTGTCTTTAAGCTCCTGCTGGGG + Intronic
1097973282 12:65657936-65657958 CTGCCTTTGGGGTGGTGATGGGG - Intergenic
1099138371 12:78937877-78937899 CTGCTTTTGGGATGCTGCTTAGG + Intronic
1099912968 12:88856121-88856143 AAGCTTTTGGGTTCCTGCTGTGG - Intergenic
1101796052 12:107975285-107975307 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1102503727 12:113370899-113370921 CTGCCTTTGGGCCACTGGTTAGG - Intronic
1102573878 12:113843925-113843947 CTGCCCCTGGCCTCCTGCTTAGG + Intronic
1103338912 12:120210805-120210827 CAGGCCTTGGGCTCCTGATGAGG - Exonic
1103975037 12:124696933-124696955 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1104345385 12:127991864-127991886 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1104503703 12:129310514-129310536 CTCCCTCTGAGCTCCTGCTGGGG + Intronic
1104621127 12:130313601-130313623 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1108105241 13:47001797-47001819 GTGCCTTTGGGGTCATCCTGGGG - Intergenic
1108690777 13:52857455-52857477 CTGGCTCTGAGCTCCTGCTTTGG + Intergenic
1110404160 13:75130403-75130425 CTGCCTTTGGGGCCATGCTGAGG + Intergenic
1111225332 13:85263827-85263849 CTGCCTTTGAGCTGCTACTCTGG + Intergenic
1113615735 13:111679494-111679516 AAGCCTTTGGGCACCTGCTCTGG + Intergenic
1113621203 13:111764396-111764418 AAGCCTTTGGGCACCTGCTCTGG + Intergenic
1114637353 14:24195398-24195420 CTGCCTTTGGGCTCCTGCTGGGG + Intronic
1119859662 14:77926976-77926998 ATGGCCTTGGGCTCCAGCTGAGG + Intronic
1122002695 14:98674801-98674823 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1122251980 14:100446181-100446203 CTGCCCCTGGGGTCCTGCGGTGG + Intronic
1122390076 14:101374076-101374098 CTGCCTTTGCCCCGCTGCTGCGG + Intergenic
1122436459 14:101704451-101704473 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1122699567 14:103578817-103578839 CTGCCTTTGGGATACTCCCGTGG + Intronic
1122906303 14:104803088-104803110 CTGCCTTAGGATCCCTGCTGGGG - Exonic
1122994804 14:105257316-105257338 CTTCCTTTGGACCCCTGCTCTGG - Intronic
1123016386 14:105377523-105377545 CAGCCTCTGGGCAGCTGCTGAGG + Intronic
1123043318 14:105499425-105499447 CTTCATTTGGGCTCCCGCTGTGG + Intronic
1125937535 15:43649384-43649406 ATTCCTGTGGGCCCCTGCTGTGG + Intronic
1125950435 15:43746804-43746826 ATTCCTGTGGGCCCCTGCTGCGG + Intronic
1126405475 15:48318307-48318329 CTCCCTCTGGTCTCCTGCTGGGG + Intergenic
1129772832 15:78213588-78213610 CTGCCCTAGGGCTGCTGTTGAGG + Intronic
1132498096 16:273347-273369 CTGCCTTGGAGCTCCTGGTGGGG - Intronic
1132702762 16:1229110-1229132 CTCCCTCTGGGCTCCAGGTGGGG - Intronic
1132705564 16:1241758-1241780 CTCCCTCTGGGCTCCAGGTGGGG + Intronic
1132819925 16:1859904-1859926 CTCCCTCCCGGCTCCTGCTGAGG + Intronic
1132986869 16:2771872-2771894 CTCCCTGTGGGCTCCTTTTGGGG - Intronic
1133103427 16:3492677-3492699 CTGCATTTAGGATCCTCCTGAGG + Intergenic
1134089824 16:11385466-11385488 CAGGCATTGGGCTCCTACTGCGG - Intronic
1138669125 16:58598689-58598711 CTGGCTTTGGGCTGGTGCTCAGG - Intronic
1138850810 16:60627399-60627421 CTGCCTCTGAGCTGCTACTGTGG - Intergenic
1139559151 16:67730613-67730635 CTGCCTTTTCGCTCTTGCCGTGG + Intronic
1139651776 16:68365814-68365836 CAGCCTTTGGGATCCTGCCAGGG - Intronic
1140124939 16:72111086-72111108 CGGCCTTCGGGCTCTGGCTGGGG + Intronic
1141746477 16:85929786-85929808 CTCCCTCTGGTCTCCCGCTGGGG - Intergenic
1142178928 16:88657823-88657845 CTGCCTCTGTGCCCCTCCTGAGG - Intronic
1142428043 16:90011200-90011222 CTGCCATGAGGCTCTTGCTGAGG + Intronic
1142866486 17:2794558-2794580 AAGCCTCCGGGCTCCTGCTGGGG + Intronic
1143828058 17:9628842-9628864 CTGGCTTGGGGCTCTAGCTGCGG + Intronic
1144269442 17:13602084-13602106 GTGCCATTGGGCGGCTGCTGCGG - Intergenic
1144667372 17:17111377-17111399 CTGCCTCAGGACACCTGCTGGGG - Intronic
1146159449 17:30552128-30552150 TGGCCTCTGGGCACCTGCTGAGG + Intergenic
1146285272 17:31570356-31570378 CTGCCTTCAGGCTCCTCCTATGG - Intergenic
1146950238 17:36900382-36900404 CTGCCTCTGGGAGCATGCTGGGG + Intergenic
1147587288 17:41659796-41659818 CTGGCTCTGGGTACCTGCTGGGG - Intergenic
1148324809 17:46777005-46777027 CTCCCTTAGGGCTCCTCCTGTGG - Intronic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1151064106 17:71131419-71131441 GTGTCTTTCGGCCCCTGCTGGGG + Intergenic
1151227215 17:72656242-72656264 GTGTCTTTGTGCTACTGCTGGGG - Intronic
1151879306 17:76885561-76885583 CTGCCCTTTGTCTCCTCCTGGGG + Intronic
1152891526 17:82884303-82884325 CTCCCTCGCGGCTCCTGCTGTGG - Intronic
1153560391 18:6367024-6367046 TTGCCTTCTGGCACCTGCTGTGG - Intronic
1154955057 18:21245072-21245094 CAGCCTTTGGGCTAATGATGGGG + Intronic
1155630131 18:27883375-27883397 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1156830320 18:41483980-41484002 CTGAGTTTGGGCACTTGCTGAGG - Intergenic
1156848464 18:41697749-41697771 CTACCTTCAGGATCCTGCTGAGG - Intergenic
1157537158 18:48468298-48468320 CTGGATTTGGGTTCCTCCTGAGG - Intergenic
1158609721 18:58928179-58928201 CTGCCTGTGAGCACCAGCTGGGG + Intronic
1159092149 18:63861333-63861355 CTGCCATGTGGCCCCTGCTGGGG + Intergenic
1159608496 18:70499497-70499519 CTGCCGCTGGGCCCCAGCTGGGG + Intergenic
1160238435 18:77104367-77104389 CTTCCTTTGGGGTCATGCTCTGG - Intronic
1160410627 18:78673334-78673356 CAGCCCCTGGGGTCCTGCTGTGG + Intergenic
1161027865 19:2044955-2044977 CTGCCCTCGGGGTCATGCTGCGG - Intronic
1161302412 19:3549003-3549025 CTGGCTTTGGGCACCAGCTGGGG + Intronic
1161331161 19:3688388-3688410 CGGCCTCTGGCCCCCTGCTGTGG + Intronic
1162720406 19:12658497-12658519 CTTCCTTTTGCCTGCTGCTGGGG + Exonic
1162880430 19:13654768-13654790 CTGCCTCTGAGCTGCTGCTTTGG - Intergenic
1163646179 19:18490456-18490478 CTGCCCATGGGCTCCCGCTGCGG - Intronic
1164600769 19:29561897-29561919 CTGCCTCTGGGCCCCTTTTGTGG - Intronic
1164779844 19:30883499-30883521 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1165115725 19:33527428-33527450 GTCCCTTTTGGCTTCTGCTGGGG + Intergenic
1165434787 19:35789882-35789904 CACCCCTTGGGATCCTGCTGTGG + Intergenic
1166338500 19:42122936-42122958 CAGCCTTGGGCCTCCTCCTGGGG + Intronic
1167015431 19:46838268-46838290 CTGCCTCTGGGCCCTGGCTGTGG - Exonic
1167121789 19:47521552-47521574 CTGCATTTGGGCTGGAGCTGAGG + Exonic
1167612714 19:50515055-50515077 CTACCTTCTGACTCCTGCTGGGG + Intergenic
1168692456 19:58385399-58385421 CAGCCTTGGGGCTCCCACTGGGG - Intergenic
926116678 2:10217866-10217888 CTGCCTTGGGCCTCAGGCTGGGG + Intergenic
926197713 2:10773815-10773837 CTGCCCTGGGGCCCCTGCTGGGG + Intronic
926383486 2:12314227-12314249 CAGCCATTGAGCTCTTGCTGTGG + Intergenic
926801422 2:16664189-16664211 CTGCCTCTGGGCTCTGGCTCTGG - Intronic
926873267 2:17446415-17446437 CTTCTGTAGGGCTCCTGCTGCGG - Intergenic
928338815 2:30423446-30423468 CTGCCTTTGGCATGCTGATGAGG - Intergenic
928615858 2:33038935-33038957 CTGCCTCTGGGCACCTGCCTGGG + Intronic
929058009 2:37895409-37895431 CTGTCTTTGGGTTCATGCTCTGG - Intergenic
929541171 2:42823422-42823444 CTGCCTTGGGGCTTCTGCAATGG + Intergenic
930423018 2:51177340-51177362 CTGGCTTTGGGCTCATACTGGGG - Intergenic
930677213 2:54215957-54215979 CTGCATTTGGGATCAGGCTGAGG + Intronic
931443133 2:62305277-62305299 CTGCCTTGGGGAAGCTGCTGAGG + Intergenic
931972126 2:67600438-67600460 CTGCCTTTGAGCTGCTACTCTGG - Intergenic
932460574 2:71879489-71879511 CAGCCTTTGGGCTCCTGGGCAGG + Intergenic
933966810 2:87436821-87436843 CTGCCCTTGGGCTTTGGCTGGGG - Intergenic
933967529 2:87442309-87442331 CTGCCCTTGGGCTTTGGCTGGGG - Intergenic
934890437 2:98063659-98063681 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
935259554 2:101343030-101343052 CTGCTTGTCGGCTACTGCTGAGG - Intergenic
936273681 2:111071911-111071933 CTGCCTTTGTGATCGTGTTGTGG + Intronic
936326266 2:111508187-111508209 CTGCCCTTGGGCTTTGGCTGGGG + Intergenic
937347612 2:121136258-121136280 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
938031963 2:128002607-128002629 TTGCTTTTGGGCTCTTTCTGGGG - Intronic
938813795 2:134878906-134878928 CTACCTTTGGGTTTCTGCTAAGG + Intronic
941646308 2:168045366-168045388 CTGCCTCTGGCCTGCTGCAGGGG - Intronic
943938943 2:193965210-193965232 CTCCCTTGGGACTCCTTCTGGGG + Intergenic
944525139 2:200611418-200611440 CTGCATTAGGGCACTTGCTGAGG - Exonic
944881645 2:204018869-204018891 CTGCCTCTGGTCTCCTGCCAGGG + Intergenic
945321198 2:208425523-208425545 CTGCCTTTGAGCTGCTACTCTGG + Intronic
946941687 2:224775873-224775895 CTGGCTTTGGGCTTGTGCCGAGG + Intronic
948948325 2:241233174-241233196 CTGGCTCTGGCATCCTGCTGGGG - Intronic
949030664 2:241795667-241795689 CTGCCATTGGGCCACTTCTGCGG - Intronic
1169811494 20:9613342-9613364 CTGCCTGTGGGTTTCTGCTCTGG - Intronic
1169980401 20:11378290-11378312 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1170467971 20:16640015-16640037 CTGGCTGTGGGCTACTCCTGGGG - Intergenic
1170681704 20:18531611-18531633 CTGCCATTGCACTCCAGCTGTGG + Intronic
1171305488 20:24102416-24102438 CTACCCTTGGACTCCTACTGGGG + Intergenic
1171339572 20:24416779-24416801 TTGGCTTTGGGCCCCTCCTGGGG - Intergenic
1171388705 20:24787215-24787237 CTGCTTTGGGGCTCCTGTGGAGG - Intergenic
1172028199 20:31963902-31963924 CTTGCTTTGGGATCCTGCTGAGG - Intergenic
1172198295 20:33107159-33107181 GTGCCTCTGCGCTCCAGCTGGGG + Intronic
1172357998 20:34292939-34292961 CTGCCGTGTGGATCCTGCTGAGG - Intronic
1172890403 20:38260325-38260347 CTGCCCTTGAACCCCTGCTGGGG + Intronic
1173033966 20:39390713-39390735 CTGCCTCTGTGCTCCTGGTCAGG + Intergenic
1173139459 20:40469723-40469745 CTGCCTTTGGGAGGCTGCTCTGG - Intergenic
1173420036 20:42892955-42892977 CTGTCATTGGGCTTCTCCTGGGG + Intronic
1173498230 20:43534207-43534229 CAGCATTTGGGCTCCCTCTGTGG + Intronic
1173555366 20:43961821-43961843 CTTTCTCTGGGCTTCTGCTGTGG - Intronic
1173807880 20:45937986-45938008 CTGCCTTTGTGGTCTTGTTGTGG + Intronic
1174501567 20:50988905-50988927 CAGCCTTTGGGCTCCAGCCCCGG + Intergenic
1176082100 20:63278668-63278690 CTGGCTTTGGGGACTTGCTGGGG + Intronic
1176243540 20:64085995-64086017 GTGCCTTTGGGGTCCTGCCTGGG + Intronic
1176411264 21:6450715-6450737 GTCCCTGTGGCCTCCTGCTGAGG - Intergenic
1178016717 21:28355347-28355369 CTGCTTTTTGGCTTCTGCTGAGG - Intergenic
1178229448 21:30764470-30764492 CTGTGTTCAGGCTCCTGCTGGGG - Intergenic
1179413544 21:41180066-41180088 CTGCCTCTGAGCTGCTACTGTGG - Intronic
1179686757 21:43059037-43059059 GTCCCTGTGGCCTCCTGCTGAGG - Intronic
1180999122 22:19979780-19979802 CTGCCCTGGTGCGCCTGCTGAGG - Exonic
1181110914 22:20602532-20602554 TTATCTTTGGGCTCCTGGTGGGG - Intergenic
1181521493 22:23450986-23451008 CTGTCATAGGGCTGCTGCTGAGG - Intergenic
1181910011 22:26231148-26231170 CTGCCTCTGAGCTACTGCTCTGG - Intronic
1182263182 22:29091014-29091036 GTGCCTTTGCACTCCAGCTGGGG - Intronic
1182307807 22:29383239-29383261 CAGCCTTGGGTCTGCTGCTGTGG - Intronic
1182472313 22:30556080-30556102 CGGCCTCCGGGGTCCTGCTGGGG + Exonic
1183178616 22:36243470-36243492 CAGCCTTTGGGTTGGTGCTGGGG + Intergenic
1183783489 22:40015213-40015235 CTGCCTCTGGGCTCAAACTGCGG - Intronic
1184660951 22:45965283-45965305 ATGGCTTAGAGCTCCTGCTGTGG + Intronic
1184758975 22:46534257-46534279 CAACCTTTGGGCTCTGGCTGTGG - Exonic
1184809017 22:46816127-46816149 CTGCCCTGGACCTCCTGCTGCGG + Intronic
1185006974 22:48285054-48285076 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
950004055 3:9680052-9680074 CTGGCTGTGGGCTCATGGTGTGG - Intronic
950709999 3:14807207-14807229 GTGCCTTTAGACTCCTGCGGTGG - Intergenic
950742750 3:15063363-15063385 CAGTCTTTGGGTACCTGCTGGGG - Intronic
951334676 3:21406315-21406337 CTGCCCCTTGGCTCCTTCTGGGG + Intergenic
951476547 3:23112659-23112681 CTGCCTTCTGGCTCCTGGTTGGG + Intergenic
952252364 3:31666660-31666682 GTGGCTTTGGGCATCTGCTGGGG - Intronic
952960724 3:38587631-38587653 CTGCCTCTTGACTCTTGCTGTGG + Intronic
953110642 3:39934650-39934672 CTGGCTTTGGAGTCCAGCTGGGG + Intronic
953195712 3:40731321-40731343 CAGGCTCTGGGCTCGTGCTGGGG + Intergenic
953460171 3:43075954-43075976 CTGGCTTTATGCTGCTGCTGTGG + Intergenic
954126668 3:48535250-48535272 CTCCCTGTGGCCTCCTGCTAGGG - Intronic
954416886 3:50397662-50397684 CTGCCTATGTGCAGCTGCTGAGG - Intronic
956286015 3:67611041-67611063 CTGCCTTTTGTCTCCTGATATGG + Intronic
956805766 3:72809459-72809481 CCGCCTTTGAGCTCATTCTGTGG - Intronic
957415356 3:79895207-79895229 CTGCCTTTGGGCTGCTACTCTGG + Intergenic
958013878 3:87915042-87915064 CTGCCTCTGGGCTGGTACTGGGG - Intergenic
961491700 3:127260999-127261021 CTGCCTTTGGTCTTGTGCTCTGG + Intergenic
961503568 3:127355238-127355260 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
961743848 3:129050822-129050844 CTGCCTTTGGTCTCCTCATCTGG - Intergenic
961945475 3:130682523-130682545 CTCCCTTTGATCTCCTGCTGCGG - Intronic
962104605 3:132377804-132377826 CTGCCATTGCACTCCAGCTGGGG - Intergenic
962278661 3:134033984-134034006 CTGTCTTGGGCCTCCTCCTGGGG + Intronic
962848379 3:139289963-139289985 CTGCCTTTGGGCCCCCTGTGTGG + Intronic
962862112 3:139414022-139414044 CTGGCTCTGGGCTGGTGCTGGGG + Intergenic
963504246 3:146163983-146164005 CTGAATTTGGGCTCATGCTTGGG - Intergenic
964179277 3:153864655-153864677 ATGCCTTGTGGCTGCTGCTGGGG - Intergenic
964406880 3:156358425-156358447 TTTCCTCTGGGCTCCTGCTCTGG - Intronic
965345213 3:167540380-167540402 CAGCCTTTGGGCTGGTGCTGGGG - Intronic
965783807 3:172315603-172315625 CTGCCTTTCTGCTCCTAATGGGG - Intronic
966679925 3:182631193-182631215 CTGGCTTTGGGAGCCTGCTTGGG - Intergenic
968276334 3:197443231-197443253 CTGCCCTTGGAATCCTGTTGAGG - Intergenic
968432882 4:569067-569089 CAGCCTCTGTGCACCTGCTGTGG - Intergenic
968707091 4:2084374-2084396 CTCCCTTGGGGCCTCTGCTGCGG + Intronic
968811784 4:2803300-2803322 AGGCCCTGGGGCTCCTGCTGGGG - Intronic
968896829 4:3409218-3409240 CTGCCCTTGGGGTCCTGCAGAGG - Intronic
969096254 4:4735029-4735051 TTGCCTGCTGGCTCCTGCTGGGG + Intergenic
969698964 4:8755256-8755278 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
969963774 4:10973600-10973622 GTGCCTTTGGGCACCAGCTAGGG - Intergenic
970384624 4:15543712-15543734 CTGCTCTGGGGCTTCTGCTGAGG + Intronic
973694596 4:53477759-53477781 CTGTCTTTTTGCTCTTGCTGTGG - Intronic
974809004 4:66921347-66921369 CTGCTTATGGGTTCCTGCTTTGG + Intergenic
975066326 4:70069084-70069106 CTGCCTTTTGGCTGTTGCTCTGG + Intergenic
975109592 4:70608746-70608768 CTAACTTTGAGCCCCTGCTGTGG - Intergenic
976338868 4:83922613-83922635 TTGCCATGGGCCTCCTGCTGTGG + Intergenic
976556152 4:86453387-86453409 CAGCCTTGGTGCTGCTGCTGGGG + Intronic
977463790 4:97358000-97358022 ATGCCTTTTGCCTCCCGCTGTGG - Intronic
977878843 4:102181338-102181360 CTGCCTTTGGGCATGTGCTATGG - Intergenic
981579379 4:146236679-146236701 CTCCCTTTGGCCCACTGCTGGGG - Intergenic
982138104 4:152292029-152292051 CAGCCTTTGTCCTGCTGCTGGGG - Intergenic
984740540 4:183157380-183157402 CTAACTTTGGTCTCCTGTTGAGG + Intronic
985764857 5:1771937-1771959 CTGCCATGGGGCTGATGCTGGGG + Intergenic
985877734 5:2613124-2613146 ATCCCATTGGCCTCCTGCTGGGG + Intergenic
985904491 5:2822973-2822995 CTGCCTTTGGGCCCCTGTGATGG - Intergenic
986483770 5:8214924-8214946 CTGAGCTTGGGCTTCTGCTGGGG - Intergenic
987006552 5:13716121-13716143 CTGCCTTTGCTCTACTGCTGTGG + Intronic
987174218 5:15291004-15291026 CTGCCTTGGGGCTTATGGTGAGG + Intergenic
988873788 5:35420791-35420813 CTACCTTTGAGCTCCCCCTGTGG - Intergenic
989586144 5:43075169-43075191 CTTCCTTTGTCCTGCTGCTGTGG + Intronic
990761677 5:59137033-59137055 CTGCCTTGGGGCTGCTGCAGAGG + Intronic
990777748 5:59322326-59322348 TTGCCTTTGGTCTCATGCAGTGG - Intronic
992661236 5:78963036-78963058 CTGCCATTAGGCTCCCACTGGGG - Intronic
992773221 5:80068562-80068584 CTGCCTTGACGCTCCTGTTGGGG + Intronic
993346756 5:86793852-86793874 CTGCCTTAGAACTCCTGCTTTGG - Intergenic
994801292 5:104380472-104380494 CTGCCTCTGAGCTCCTACTCTGG + Intergenic
995472941 5:112522916-112522938 CTGGCTCTGGGCTCATACTGGGG + Intergenic
997480868 5:134183690-134183712 CTGCCCTTGGGAAGCTGCTGTGG + Intronic
997864191 5:137446425-137446447 TTGCCTCTGGGCCACTGCTGTGG - Intronic
998705683 5:144757361-144757383 CTGCTCTTGGGTTCCTGCTCTGG - Intergenic
999673185 5:153975212-153975234 CTGCCTTTGTCCTCCTGCCAGGG + Intergenic
999737115 5:154521197-154521219 CTGCCTACGGGCTCCTGTAGGGG + Intergenic
1000237613 5:159377057-159377079 CAGGCTTTGGGCTGGTGCTGAGG - Intergenic
1000676740 5:164131066-164131088 CTGCCTTTGACCTCCTCCTATGG + Intergenic
1001053445 5:168430721-168430743 CTGCCTGTGGGCTCCTCCCATGG + Intronic
1001251412 5:170149749-170149771 CTTCTTTGGGGCTCCTCCTGAGG - Intergenic
1001275872 5:170351154-170351176 CTGCATTTGGGCCCCAGCTCAGG - Intergenic
1001382823 5:171315306-171315328 CTGCCTCTGGGCGACAGCTGCGG + Intergenic
1001575047 5:172757847-172757869 CAGCGTTTGGGGTCCTGCTGTGG - Intergenic
1001595594 5:172896810-172896832 CTGCCTTTGGGGTACTGGTCTGG - Intronic
1002359357 5:178658513-178658535 CTGACTGTCGGCTCCTCCTGTGG + Intergenic
1002841987 6:914085-914107 TGGCCTCTGGGCTCCTGATGTGG + Intergenic
1003276598 6:4659172-4659194 CTGACTTTGGGGTGGTGCTGGGG - Intergenic
1003395424 6:5748781-5748803 CTGCCTGTGGGCGAATGCTGTGG + Intronic
1003531641 6:6942020-6942042 CTGCCTGTGCGCTGCTGCTTTGG - Intergenic
1003543945 6:7042618-7042640 CGGGCATTCGGCTCCTGCTGGGG + Intergenic
1006408431 6:33858171-33858193 CATCCTTTTGGCTCCAGCTGGGG - Intergenic
1007356262 6:41319869-41319891 CTGCCCTGGGTCTCCTGCAGAGG + Intergenic
1007524862 6:42482998-42483020 CAGCCTTGGGGCTTCTGCTCAGG + Intergenic
1007961305 6:45962336-45962358 CTGCCTTTGGACTCGAACTGCGG - Intronic
1010193988 6:73222499-73222521 ATGCCATTGTACTCCTGCTGGGG - Intronic
1010921903 6:81692415-81692437 CTCCCTCTGATCTCCTGCTGAGG - Intronic
1013091794 6:106906846-106906868 CTGGGTTTCGGCTCCTGGTGAGG - Intergenic
1015830704 6:137365865-137365887 CTGCCTTTGTGCTCCGTGTGGGG + Intergenic
1016247143 6:141995495-141995517 CTGTCCTTGGGCTCCAGTTGTGG - Intergenic
1016489641 6:144583250-144583272 CTGCCTGTGAGCATCTGCTGGGG + Intronic
1016797803 6:148136584-148136606 CTGCCCTAGGGCTCCTCCTGAGG + Intergenic
1017881388 6:158565039-158565061 CACCCCTTGGGCCCCTGCTGCGG + Intronic
1018215356 6:161521082-161521104 ATGACTTTGAGATCCTGCTGAGG - Intronic
1018536368 6:164824961-164824983 CTGCCTTCGAGCTGCTGCTCTGG + Intergenic
1019132465 6:169887257-169887279 CTCCATTTGTGCTCCTGCTCTGG - Intergenic
1019557365 7:1639367-1639389 CTGTCTTGGGACACCTGCTGTGG - Intergenic
1019589847 7:1825496-1825518 CTGTCATAGGGCTGCTGCTGAGG + Intronic
1019915911 7:4132393-4132415 ATGCCGTTGGGCTCCTCCGGAGG - Exonic
1019929244 7:4212632-4212654 CTGCTTCTGGGCCTCTGCTGTGG - Intronic
1020856782 7:13437045-13437067 CTGCATCTGAGCTCCTGCTCGGG - Intergenic
1021229441 7:18067936-18067958 TTGCCTTTGGGCACCTGGTTGGG - Intergenic
1021539172 7:21737749-21737771 TTGCCTTTGTGGTCCTGCTTAGG - Intronic
1022539732 7:31124543-31124565 CTTCCATTGAGTTCCTGCTGAGG + Intergenic
1022716688 7:32905342-32905364 CTGCCTTTGAGCTGCTACTCTGG - Intergenic
1023106439 7:36767645-36767667 CTGCCTTTGGCTTACTGATGAGG + Intergenic
1024181666 7:46901398-46901420 CTGCCATTGTGTTCCTGCTGCGG + Intergenic
1024219493 7:47276853-47276875 CCACCTTGGGGTTCCTGCTGGGG - Exonic
1024388671 7:48781959-48781981 CTGCTTGTGGGCTTCTGCTGTGG + Intergenic
1024818410 7:53297971-53297993 CTGCCTTTGCGGCCCTGCAGTGG + Intergenic
1025100442 7:56130434-56130456 CTGGCTTTGGGCTGCAGTTGAGG - Intergenic
1025147791 7:56519950-56519972 CTGGCTTTGGGCTGCAGTTGAGG - Intergenic
1025187353 7:56871425-56871447 TTGGCTTAGGGCTGCTGCTGGGG + Intergenic
1025188768 7:56881235-56881257 TTGGCTTAGGGCTGCTGCTGGGG + Intergenic
1025683167 7:63695685-63695707 TTGGCTTAGGGCTGCTGCTGGGG - Intergenic
1025684572 7:63705495-63705517 TTGGCTTAGGGCTGCTGCTGGGG - Intergenic
1026082340 7:67232943-67232965 CTGCCTTTGGGTTTTTGGTGGGG + Intronic
1026222940 7:68416041-68416063 CTGCCTTTGAGCTGCTACTCTGG + Intergenic
1026318607 7:69249371-69249393 CTGGCTTTGGGCTGCAGTTGAGG + Intergenic
1026694733 7:72581051-72581073 CTGCCTTTGGGTTTTTGGTGGGG - Intronic
1029406127 7:100374902-100374924 CAGCCACTGGGCACCTGCTGGGG - Intronic
1029688415 7:102164650-102164672 CAGCATTTGGTCTCCAGCTGTGG + Intronic
1030152073 7:106417517-106417539 ATGCCCTTGGGCTTCTGCTGAGG + Intergenic
1031485210 7:122316446-122316468 CTCGCTCTGAGCTCCTGCTGGGG + Intergenic
1031979072 7:128112715-128112737 CTGCCTGGGGCCTGCTGCTGCGG + Intergenic
1033269735 7:139920088-139920110 CAGCCATTCAGCTCCTGCTGTGG + Intronic
1034445973 7:151114659-151114681 CGGCCTCTGGGCACCTGGTGTGG - Intronic
1035110663 7:156478851-156478873 CTGCCTATGTGCTCCTACAGAGG + Intergenic
1035221674 7:157409993-157410015 CTCCCTTTGCACACCTGCTGCGG - Exonic
1035230503 7:157463169-157463191 CTGGCTGTGGGCGTCTGCTGGGG - Intergenic
1035813895 8:2517432-2517454 CTGGCTTTGGCCTCCAGCGGAGG + Intergenic
1036162566 8:6403413-6403435 CTGCCATTGGCCTCCCTCTGAGG + Intergenic
1036643018 8:10595760-10595782 CTGCCTCGGGGCTCCTGCCTTGG + Intergenic
1037530686 8:19769858-19769880 CTGCCTCTGGGCTGCTACTCTGG + Intergenic
1037825259 8:22156683-22156705 CTGCCCTCGGGCGCCGGCTGCGG + Exonic
1038490929 8:27970574-27970596 CTGCCTCTGAGCTCCTGTTCTGG + Intronic
1038863799 8:31416362-31416384 CTCCCTTTGGGCCCATTCTGAGG + Intergenic
1041840671 8:62266890-62266912 CTGCCTTTGAGCTGCTCCTCTGG + Intronic
1042999291 8:74737356-74737378 CTGCCCTTGAGCTGCTGCTTGGG + Intronic
1044744303 8:95357378-95357400 CTGCCTTTCGGCTCCTTCTGGGG + Intergenic
1045508558 8:102795516-102795538 CTGCCTTTCGCCTCCTGGAGGGG - Intergenic
1045811907 8:106231667-106231689 CTGCCCTTGGTCTGCAGCTGGGG - Intergenic
1046575736 8:116026675-116026697 CAGCCTTCGGGCTCCTTGTGGGG + Intergenic
1047764988 8:127983120-127983142 CTCCCTCTGGCCTCCTGTTGAGG + Intergenic
1048414469 8:134210904-134210926 CTGCCCTTGGGATTCTGCTCTGG + Intergenic
1048509889 8:135052735-135052757 TTTCCTTTAGGCTCCTGTTGAGG - Intergenic
1049296887 8:141845498-141845520 CTGCCTTTGGGCTTCCTCAGGGG - Intergenic
1049326757 8:142025548-142025570 CTGCCTTTGGCCTCCTCGTTGGG - Intergenic
1049454021 8:142677939-142677961 CTGCCTTTGGGCTTCCCCCGGGG - Intronic
1049512754 8:143038012-143038034 CTCCTGCTGGGCTCCTGCTGGGG - Intergenic
1049559772 8:143304035-143304057 TTGCCTTTGGGCGGGTGCTGTGG - Intergenic
1049605322 8:143526597-143526619 TTGCCTGAGGGCCCCTGCTGTGG - Intronic
1049832706 8:144712636-144712658 TTGCTTCCGGGCTCCTGCTGTGG + Intergenic
1053413060 9:37928209-37928231 CTGCCTTGTTCCTCCTGCTGTGG - Intronic
1056283155 9:85062157-85062179 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1057707455 9:97406420-97406442 CTGGCTTAGGGCCCCCGCTGTGG - Intergenic
1057855921 9:98600671-98600693 CTGCCTTGGGGAACCTGCAGAGG - Intronic
1059496960 9:114717949-114717971 CTACCTCTGCCCTCCTGCTGTGG + Intergenic
1059642936 9:116235176-116235198 CTGAATTTGGGCTCCAGGTGCGG - Exonic
1060528616 9:124334571-124334593 CTGCCTTGGAGCTCCAGCAGAGG + Intronic
1060556050 9:124507645-124507667 CTGCCTCTGGGCTCCCACAGCGG - Intergenic
1060743888 9:126117281-126117303 CTGCCTTTGAACTTCTGCAGTGG - Intergenic
1061009432 9:127946361-127946383 GTCCCTTTTGCCTCCTGCTGGGG - Intronic
1061972303 9:134051330-134051352 CTGCCTTTGAGCCCACGCTGGGG - Intronic
1062131233 9:134894536-134894558 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1062150114 9:135013841-135013863 CTGACTTTGGGCCCCCGGTGAGG - Intergenic
1062462681 9:136668453-136668475 CTCCCTGGGGGCTCCTGCTGAGG + Intronic
1185772935 X:2779291-2779313 CTGCCATTGCACTCCAGCTGAGG + Intronic
1185870638 X:3662229-3662251 CTTCCTTTGGCCTTCAGCTGTGG - Intronic
1186897056 X:14014100-14014122 CTGCCTTTGGGCTCTATGTGTGG - Intronic
1187571887 X:20512654-20512676 CTGCCTGTGGGCACCTGCTGAGG + Intergenic
1189487683 X:41445714-41445736 CAGCCTCTGGACTGCTGCTGGGG + Intergenic
1189984775 X:46544339-46544361 CTGGGTCTGGGCTCTTGCTGAGG + Intronic
1192197335 X:69037180-69037202 CTGCCTTCCTGCTCCTGCAGGGG - Intergenic
1192905172 X:75543806-75543828 CTGACTTTTGGCTGGTGCTGAGG + Intergenic
1193076623 X:77362579-77362601 CTGGCTCTGGGCTGGTGCTGGGG + Intergenic
1193255442 X:79343039-79343061 CAGGCTCTGGGCTGCTGCTGGGG - Intergenic
1193449807 X:81651818-81651840 CTGCTTATGGGTTTCTGCTGTGG + Intergenic
1195277903 X:103300095-103300117 CTGCTTTTGGGCTGCTACTCTGG - Intergenic
1195621836 X:106964250-106964272 CTGCCTTTGAATTCCTGCGGTGG - Intronic
1196063576 X:111438022-111438044 CTGTCTTTGGGATGCTGGTGAGG + Intergenic
1198450826 X:136766112-136766134 CTGCCCTTGTGCTTCAGCTGAGG - Intronic
1199089219 X:143671686-143671708 CTGCCCTGGGGCTGATGCTGTGG - Intergenic
1199239608 X:145530771-145530793 CTGCCTTTTGACCTCTGCTGAGG + Intergenic
1200012434 X:153128824-153128846 GTGCCTTTGGGCTCCTTGGGCGG + Intergenic
1200027165 X:153271095-153271117 GTGCCTTTGGGCTCCTTGGGCGG - Intergenic
1200793394 Y:7318901-7318923 CTTCCTTTGGCCTTCAGCTGTGG + Intergenic