ID: 1114639978

View in Genome Browser
Species Human (GRCh38)
Location 14:24213184-24213206
Sequence GAGTGGGGGAGGACGGCGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 634}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114639966_1114639978 6 Left 1114639966 14:24213155-24213177 CCTCCCAGATCTTGAGTTCTTCC 0: 1
1: 0
2: 0
3: 22
4: 204
Right 1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG 0: 1
1: 0
2: 2
3: 53
4: 634
1114639964_1114639978 8 Left 1114639964 14:24213153-24213175 CCCCTCCCAGATCTTGAGTTCTT 0: 1
1: 0
2: 1
3: 29
4: 362
Right 1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG 0: 1
1: 0
2: 2
3: 53
4: 634
1114639963_1114639978 21 Left 1114639963 14:24213140-24213162 CCTCAACTCAAGTCCCCTCCCAG 0: 1
1: 0
2: 2
3: 27
4: 260
Right 1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG 0: 1
1: 0
2: 2
3: 53
4: 634
1114639968_1114639978 2 Left 1114639968 14:24213159-24213181 CCAGATCTTGAGTTCTTCCCTCT 0: 1
1: 0
2: 0
3: 21
4: 334
Right 1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG 0: 1
1: 0
2: 2
3: 53
4: 634
1114639962_1114639978 22 Left 1114639962 14:24213139-24213161 CCCTCAACTCAAGTCCCCTCCCA 0: 1
1: 0
2: 2
3: 23
4: 257
Right 1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG 0: 1
1: 0
2: 2
3: 53
4: 634
1114639967_1114639978 3 Left 1114639967 14:24213158-24213180 CCCAGATCTTGAGTTCTTCCCTC 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG 0: 1
1: 0
2: 2
3: 53
4: 634
1114639965_1114639978 7 Left 1114639965 14:24213154-24213176 CCCTCCCAGATCTTGAGTTCTTC 0: 1
1: 0
2: 0
3: 35
4: 288
Right 1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG 0: 1
1: 0
2: 2
3: 53
4: 634
1114639961_1114639978 27 Left 1114639961 14:24213134-24213156 CCACGCCCTCAACTCAAGTCCCC 0: 1
1: 0
2: 2
3: 22
4: 2291
Right 1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG 0: 1
1: 0
2: 2
3: 53
4: 634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114639978 Original CRISPR GAGTGGGGGAGGACGGCGGA CGG Intronic
900101806 1:965143-965165 GCGTCGGGGAGGATGGCGGCGGG - Exonic
900117884 1:1036247-1036269 GAGTGGGGGATGATGGCTGGAGG + Intronic
900149096 1:1170533-1170555 GAGAGGAGGAGGAGGGAGGAGGG - Intergenic
900227718 1:1540682-1540704 GAGAGGCGGAGGAAGGCGGCGGG - Intergenic
900314012 1:2048189-2048211 GAGTGGGGGAGCTGGGCCGACGG + Intergenic
900344648 1:2205071-2205093 GCGTGGGGGAGCCCGGGGGAAGG - Intronic
900391596 1:2436236-2436258 GAGGAGGGGAGGAGGGAGGAAGG - Intronic
900391678 1:2436470-2436492 GAGGAGGGGAGGAGGGAGGAAGG - Intronic
900965993 1:5959030-5959052 GAGTGGGGGCGGGGGGCGGGGGG + Intronic
901144094 1:7053618-7053640 GAGTGAGGGAGGAAGGGGAAGGG - Intronic
901740317 1:11338017-11338039 AAGAGGGGGAGGAGGGGGGAAGG - Intergenic
902280572 1:15371348-15371370 TAGTGGAGGAGGACGGGGGAGGG + Intronic
902336788 1:15758743-15758765 GAGGGGGCGGGGAGGGCGGACGG + Intronic
902505876 1:16938882-16938904 GGGTGGGGGAGGGAGGCAGAAGG - Intronic
902667893 1:17952364-17952386 GAGAGGGAGAGGCTGGCGGATGG + Intergenic
903203088 1:21759295-21759317 GAGTGGGGGAGGGAGAGGGAGGG + Intronic
903331614 1:22599764-22599786 GAGAGAGGGAGGAAGGGGGAGGG + Intronic
903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG + Intronic
904128681 1:28260092-28260114 GAGTGGGGGAGGGGTGCCGAGGG - Intronic
904532964 1:31181468-31181490 GAGTGGGGCGGGGCGGGGGAGGG - Exonic
904542113 1:31239975-31239997 GAGTTGGGGGGAACGGCAGAGGG + Intergenic
904582325 1:31553846-31553868 GAGTGGGGGAGGGGGGTGGAAGG - Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
905315418 1:37079748-37079770 GAGAGGGAGAGGGAGGCGGAGGG - Intergenic
905665666 1:39761607-39761629 GTGAGTGGGAGGAGGGCGGAGGG - Intronic
905906583 1:41622389-41622411 GGGTGGGGGAGGAAGAAGGATGG + Intronic
908016686 1:59846582-59846604 GAGGGAGGGAGGAGGGAGGAAGG - Intronic
908132059 1:61083377-61083399 GAGTTCGGGAAGACGGCGGGGGG - Intronic
908355357 1:63322191-63322213 GTGGGGGGGAGAAGGGCGGAAGG + Intergenic
908422211 1:63970069-63970091 GAGTGGGGGAGGAAGACGCAAGG - Intronic
909020773 1:70428240-70428262 GAGGTGGGGAGGACAGAGGATGG + Intronic
911049228 1:93655380-93655402 GAGTGTGGGAGGTGGGGGGATGG + Intronic
912727015 1:112067609-112067631 GAGAGTGGGAGGAGGGCAGAGGG - Intergenic
912730007 1:112093793-112093815 GAGGGAGGGAGGAAGGAGGAAGG + Intergenic
912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG + Intergenic
913109146 1:115642178-115642200 GAATGCGGGAGGAGGGCGCAGGG - Intronic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915329837 1:155103999-155104021 GAGGGAGGGAGGAGGGAGGAAGG + Intergenic
916305169 1:163322069-163322091 GAGCGCGAGAGGACGGAGGAAGG + Exonic
916332049 1:163628292-163628314 GAGGGGAGGAGGAGGGGGGAGGG - Intergenic
917168560 1:172143503-172143525 GAGAGGGGGAGGAAGGTGGGAGG - Intronic
917869469 1:179229190-179229212 GCGTGGGGGAGGCCGGGGGTGGG - Intronic
918006826 1:180549007-180549029 GATTGGGGGAGGAGGGCAGGAGG - Intergenic
920536395 1:206739433-206739455 GGGTGGGGGAGGACTTAGGAAGG - Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921070605 1:211654940-211654962 GCGTGGGGGAGGCCGGAGAAGGG - Intergenic
921155225 1:212433488-212433510 GAGTGGCGGGGGACGGAGGGAGG + Intronic
921183019 1:212646188-212646210 GAGTGGGAGAAGGGGGCGGAGGG - Intergenic
921190234 1:212701183-212701205 GAGGCGGGGAGGAAGACGGAGGG + Intergenic
921215028 1:212929277-212929299 GAGGGGGGGATGACAGAGGAGGG - Intergenic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
923109553 1:230879876-230879898 GAGAGGGGGAAGCCGGCAGAGGG - Intergenic
923134536 1:231106630-231106652 GAGAGGGAGAGGAAGGAGGAGGG - Intergenic
923342807 1:233022043-233022065 GAGTGGGAGAGAAGGGAGGAGGG - Intronic
923859963 1:237883630-237883652 GGGAGGGGGAGGGCGGGGGAGGG + Intronic
923859969 1:237883640-237883662 GGGCGGGGGAGGGCGGGGGAGGG + Intronic
923859988 1:237883671-237883693 GGGCGGGGGAGGGCGGGGGAGGG + Intronic
923859994 1:237883681-237883703 GGGCGGGGGAGGGCGGGGGAGGG + Intronic
923860000 1:237883691-237883713 GGGCGGGGGAGGGCGGGGGAGGG + Intronic
923860006 1:237883701-237883723 GGGCGGGGGAGGGCGGGGGAGGG + Intronic
923860012 1:237883711-237883733 GGGCGGGGGAGGGCGGGGGAGGG + Intronic
924581916 1:245330599-245330621 GAGTGGGGGAGGGAGGAGGGAGG + Intronic
1062812541 10:477467-477489 GAGGTGGGGAGGAAGGTGGATGG + Intronic
1062812555 10:477501-477523 GAGGTGGGGAGGAAGGTGGATGG + Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064114766 10:12568330-12568352 GAGGGGGAGAGGAGGGGGGAGGG - Intronic
1064363612 10:14687637-14687659 GGGTGGGGGAGGGCTGGGGAGGG + Intronic
1064645269 10:17453985-17454007 GAGTGGGGGAGGGGGTCGCAGGG - Intronic
1064778867 10:18810830-18810852 GAGAGGGGGAGGGAGGAGGAGGG - Intergenic
1064890082 10:20161518-20161540 GAGTGGGAGAGGACGACAGAGGG + Intronic
1065728711 10:28691537-28691559 GGGAGGGGGAGGGAGGCGGAGGG - Intergenic
1069184075 10:65400471-65400493 GAGTGGTGGGGGAAGGGGGAAGG - Intergenic
1069770149 10:70893482-70893504 GAGTGGGGAAGGATGAGGGAAGG + Intergenic
1070574848 10:77670284-77670306 GAATGAGAGAGGAAGGCGGAGGG + Intergenic
1070711947 10:78689298-78689320 GAGGGCGGGAGGAGGGAGGAAGG + Intergenic
1070821849 10:79360625-79360647 CAGTGGGGGAGGGCGGGGCATGG + Intergenic
1072021926 10:91410618-91410640 GAGTTGGGAGGGACGGCGGCCGG + Intronic
1073491139 10:103854473-103854495 GTTTGGGGGAGGAAGGGGGAGGG + Intronic
1074147056 10:110726095-110726117 GAGAGGGAGAGGCCGGCAGAGGG - Intronic
1074165763 10:110872349-110872371 CAGAGGGGGAGGAGGGCTGAGGG - Intronic
1075075713 10:119349026-119349048 GTGGGTGGGAGGAGGGCGGAGGG - Intronic
1075609509 10:123841021-123841043 GGGTTGGGGAGGACTGCAGACGG + Intronic
1076049486 10:127321228-127321250 GAGAGGGGGAGGACGGGGAGGGG - Intronic
1076551236 10:131279271-131279293 GAGAGGGGGAGGAAGGAGGGAGG + Intronic
1076657839 10:132036539-132036561 GCGTGGGGGAGGATCGCGGCGGG + Intergenic
1077216199 11:1396192-1396214 GAGTGGGGGACGTGGGTGGAAGG - Intronic
1077216212 11:1396228-1396250 GAGTGGGGGACGTGGGTGGAAGG - Intronic
1077216225 11:1396264-1396286 GAGTGGGGGACGTGGGTGGAAGG - Intronic
1077251924 11:1564555-1564577 GGGTGGGGGAGGAGGGCAGGAGG - Intronic
1077321051 11:1942122-1942144 GAGTGGGGGAGGAAGGTGGGAGG + Intergenic
1077368491 11:2170819-2170841 GGGCGGGGGAGGACGGGGGAGGG + Intronic
1077449886 11:2634317-2634339 GGGTGGGGGGGGAGGGGGGAGGG - Intronic
1077922922 11:6655334-6655356 GAGTCGGGGAGGGTGGCGGCGGG - Intronic
1078208747 11:9253082-9253104 GAGTGGGGGAGGATGGCTTTAGG - Intronic
1078660430 11:13281335-13281357 GAGTGGGGGAGGCTGGCAGGAGG - Intronic
1079311125 11:19366836-19366858 GAGAGTGGGAGGACGGGGAAGGG - Intronic
1080114569 11:28607226-28607248 GAGGGGGAGAGGAGGGAGGATGG - Intergenic
1082859625 11:57842337-57842359 GAGTGAGGGAGGTCAGAGGATGG + Intergenic
1083317905 11:61827817-61827839 GAGTGGGGGAGGGAGGAGGTCGG + Exonic
1083822688 11:65181879-65181901 GAGGGAGGGCGGAGGGCGGAGGG + Intronic
1084062979 11:66687778-66687800 GGGTGGGGGAGTACTGGGGATGG - Intronic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084195538 11:67522195-67522217 GAGTAGGTGAGGACGGCCCAAGG - Intronic
1084307708 11:68297820-68297842 AACTCGGGGAGGAGGGCGGAGGG - Intergenic
1084421611 11:69063315-69063337 GAGTGGGAGGGGACGGCAGAGGG - Intronic
1084636732 11:70398180-70398202 GAGCGGACGAGGACGGCTGAGGG + Intergenic
1085423234 11:76381161-76381183 GGGCGGGGGAGGAAGGCTGAGGG - Intergenic
1090131649 11:124148397-124148419 GAGTTGGGGAAGACGGAGGATGG - Intergenic
1090190136 11:124761869-124761891 GTGTGGGGGCGGATGGCGGGGGG - Intronic
1090596533 11:128326934-128326956 GAGTTGGGGAGGGAGGCAGAAGG - Intergenic
1090968167 11:131616364-131616386 GAGTGGGAAATGACCGCGGACGG + Intronic
1091622241 12:2097885-2097907 GAGTGGGGGATGAGGCCGGCTGG + Intronic
1091773740 12:3170720-3170742 GAGTTGGGGAGGATGGCAGGAGG + Intronic
1091976577 12:4830566-4830588 GCGGGGTGGAGGATGGCGGAAGG - Intronic
1091985824 12:4909810-4909832 GGGTTGGGGAGGGCGGGGGAGGG - Intergenic
1092253490 12:6914409-6914431 GAGTGGGGAAGGGAGGAGGATGG - Intronic
1094186518 12:27648870-27648892 GAGAGGTGGAGGATGGCGAAGGG + Intronic
1094599761 12:31898203-31898225 GAGTGGGGGAGGGGAGGGGAGGG + Intergenic
1094623996 12:32106306-32106328 GAGAGGGGGACGACGGAGGAGGG + Intergenic
1095812292 12:46383632-46383654 GAGGCGGGGAGGAGGGGGGAAGG + Intergenic
1097054477 12:56241504-56241526 GAGTAGGGGAGGGAGGCTGAAGG + Exonic
1098508395 12:71282162-71282184 AAGTGGGGGAGGGAGGTGGAGGG + Intronic
1101661329 12:106768093-106768115 GGGTGGGGGAGGAGGGAGCACGG + Intronic
1102194721 12:111016889-111016911 GAGAGAGGGAGGAGGGAGGAAGG - Intergenic
1102290284 12:111693639-111693661 GAGTGGGGTAGAAGGGAGGAAGG - Intronic
1102973332 12:117188983-117189005 GAGTGGGGGTGGAGGGAGCAGGG - Intronic
1103238959 12:119397884-119397906 GGGTGGGGGAGGAAGGGGGCAGG + Intronic
1103239074 12:119398126-119398148 GAGGGGAGGAGGAAGGCGGGGGG + Intronic
1104004619 12:124883236-124883258 GAGGGAGGGAGGAAGGAGGAAGG + Intergenic
1105002667 12:132701432-132701454 GAGGGGGGGAGGAAAGAGGAAGG - Intronic
1105029027 12:132869733-132869755 GAGTGGCGGGCGACGACGGAGGG + Exonic
1105265091 13:18808596-18808618 GAGTGGGGGAGGTTGGTGGCTGG + Intergenic
1105356934 13:19667286-19667308 CAGTCGGGGAGGATGGCGGTGGG - Intronic
1105520891 13:21130031-21130053 GAGTGAGTGAGGACTGAGGATGG + Intergenic
1107797308 13:44065776-44065798 GAGTGGGGGAGTAGGGAGTATGG - Intergenic
1107834917 13:44405295-44405317 GAGTGGGGAAGGAAGGTGGGAGG - Intergenic
1107888797 13:44896286-44896308 GAGGGCGGGAGGAAGGAGGATGG - Intergenic
1110630316 13:77698599-77698621 GAGCGGGGGCGGGGGGCGGACGG + Intronic
1110749290 13:79093884-79093906 GCGTGGGGGGGGAGGGGGGAGGG + Intergenic
1112214356 13:97414980-97415002 GACTTGGGGAGGACAGAGGAGGG - Intergenic
1112309757 13:98308005-98308027 GAGTGGGGGCGGGCGGAGGGGGG - Intronic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112391592 13:98989846-98989868 GAGTGGGGGAAGAGGGGGAATGG - Intronic
1112506369 13:99978677-99978699 GAGGGAGGGAGGACTGGGGAGGG + Intergenic
1112703952 13:102044726-102044748 GAGTGGTGGAGGATGGTGGAAGG - Intronic
1113724388 13:112587700-112587722 GAGCCGGGGAGGACAGCGGAGGG - Intronic
1113899611 13:113788889-113788911 GAGTGGGGCAGGAGGGAGGGAGG - Intronic
1113909778 13:113836473-113836495 CGGAGGGGGAGGACGACGGAGGG + Intronic
1113954369 13:114089298-114089320 GAGGGGGGGAGGAGGGGGGAGGG + Intronic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114517606 14:23309820-23309842 GAGTGGGAGAGGAGGGTGGCAGG - Exonic
1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG + Intronic
1114649875 14:24277752-24277774 GACTGTGGGAGGAGGGTGGAAGG + Intergenic
1117200448 14:53384703-53384725 GATTGGGGGAGGCCGGCAGATGG - Intergenic
1117294983 14:54370921-54370943 GACTGGGGGAGGAGGACGGGGGG - Intergenic
1117840561 14:59856501-59856523 GAATGAGGGAGGACAGCAGATGG - Intronic
1119104630 14:71912528-71912550 GAGCTGGGGAGGATGGCTGATGG + Intergenic
1119205170 14:72788641-72788663 GAGGTGGGGAGGAGGGCAGAGGG - Intronic
1119386472 14:74260626-74260648 GAGTCGGGGAGGAAGCCCGAGGG + Exonic
1119739339 14:77004080-77004102 GAGTGGGGTAAGACAGTGGAAGG + Intergenic
1121167339 14:91817784-91817806 GAGTTGGGGAAGATGGAGGAAGG + Intronic
1121279161 14:92687272-92687294 TAGGGGTGGAGGACGGCGGGCGG + Intronic
1121567747 14:94923490-94923512 GAGGGGGGGAGGGGGGAGGAGGG - Intergenic
1122129813 14:99598521-99598543 GAGTGGGGGAAGGCGGTGCAGGG - Intronic
1122144263 14:99679934-99679956 CAGTGGGGGAGGAGGGGCGAGGG - Exonic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122527128 14:102394950-102394972 GAGCAGGACAGGACGGCGGAAGG - Intronic
1123433274 15:20236219-20236241 GAGTGGGGAGGGACTGCTGAAGG - Intergenic
1123627880 15:22239855-22239877 GAGAGGGTGAGGAAGGGGGAGGG - Intergenic
1123827924 15:24101692-24101714 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123842383 15:24261103-24261125 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123857412 15:24427162-24427184 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123862043 15:24477694-24477716 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1124115503 15:26839054-26839076 GAGCGGGAGAGCACGGAGGACGG + Intronic
1124835635 15:33194230-33194252 GAGGGCGGGAGGGCGGGGGACGG - Intronic
1124956570 15:34364224-34364246 GAGTGGTGGAGGAGGTCCGAAGG - Exonic
1125284069 15:38073277-38073299 GGGTGGGGGAGGCCGGGAGAGGG - Intergenic
1125300696 15:38251969-38251991 GAAAGGGGGAGGGAGGCGGAGGG - Intergenic
1125592171 15:40861630-40861652 GGGTGGGGGAGGACTGTGAATGG - Intergenic
1125848220 15:42878593-42878615 GAGTGGGGGAGGAGAGCAGCTGG - Exonic
1126849276 15:52787641-52787663 GAGTGGGGGGGGAGGGGGCATGG + Intronic
1128077609 15:64837749-64837771 GAGGTGGGGAGGAAGGGGGAGGG - Intergenic
1128768735 15:70266521-70266543 GAGACAGGGAGGAGGGCGGAAGG - Intergenic
1129784345 15:78299340-78299362 GAGTGGGGGAGGCCCGTGGGTGG - Intronic
1129854014 15:78811480-78811502 GAGTGAGGGAGGGCGGCTGCCGG + Intronic
1130127384 15:81105201-81105223 GGGTGGGGGAGAAAGGAGGAGGG - Intronic
1130151202 15:81313070-81313092 GAGTGGGGCAGGAGGCAGGAAGG + Exonic
1132074690 15:98810134-98810156 GTGTGGGGGTGGCTGGCGGAGGG + Intronic
1132105266 15:99058786-99058808 GAGTGGGGGAGAATAGCGGGGGG - Intergenic
1132513788 16:356753-356775 GAGCGGGGGAAGAGGACGGACGG + Intergenic
1132664056 16:1073627-1073649 GGGTGGGGGAGGAGGGCCAAGGG - Intergenic
1132700178 16:1218888-1218910 GGTTGGGGGAGGACGGGGGTGGG + Intronic
1132803153 16:1763886-1763908 GGGTGGGAGAGGACGGCGGGTGG + Intronic
1132989803 16:2786871-2786893 GAGGGGGTGAGGATGGGGGAGGG - Intronic
1133981699 16:10637436-10637458 GAGGGGAGGAGGAAGGAGGAGGG + Intronic
1134449674 16:14355425-14355447 GAGTGGGGGGGGGGGGCGGGGGG + Intergenic
1134452145 16:14370180-14370202 CAGTGGGGGAGGACTCAGGAGGG + Intergenic
1134897629 16:17903325-17903347 GTGTGGGGGAGTGGGGCGGAGGG + Intergenic
1134948712 16:18342128-18342150 GAGGAGGGGAGGAAGGAGGAGGG + Intergenic
1135338722 16:21628460-21628482 AAGTGGGGGAGGACAGGGGAGGG - Intronic
1135438899 16:22449662-22449684 AAGTGGGGGGGGGCGGCGGTGGG - Intergenic
1135631012 16:24035601-24035623 GAGAAGGGGAGGGTGGCGGAGGG + Intronic
1135745762 16:25015152-25015174 GGCTGGGGGCGGAGGGCGGAGGG - Intronic
1136043842 16:27600587-27600609 GAATGGGGGAGGGCGGAGCAGGG - Intronic
1136096836 16:27962960-27962982 GAGTGGGAGAGGCTGGTGGATGG - Intronic
1136197960 16:28667017-28667039 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136259027 16:29061039-29061061 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136364787 16:29805041-29805063 GACTGGGGGAGGGCGGGGGCGGG + Intronic
1136556562 16:31010658-31010680 GCGCGGGGGAGGGGGGCGGAGGG + Intergenic
1136851351 16:33614903-33614925 GAGTGGGGAGGGACTGCTGAAGG + Intergenic
1137535845 16:49324853-49324875 GCATGGGGGAGGCAGGCGGAGGG - Intergenic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137688220 16:50401766-50401788 GAGTGGGGAAGGACATGGGAGGG - Intergenic
1138439789 16:57027027-57027049 GAGTGGAGGAGGACCGGGGAGGG + Intronic
1138519090 16:57560572-57560594 GAGTGGGGGAGGATGTGGGGAGG + Intronic
1138567876 16:57846601-57846623 GAGTGGGGGAGAAAGGAGGGAGG - Intronic
1138588453 16:57986134-57986156 GGGTGGGGGTGGACGCGGGAGGG + Intronic
1139709308 16:68763627-68763649 AAGTGGGGGAGGAGGGCCGAGGG - Intronic
1140462222 16:75148839-75148861 GCGGGGGCGGGGACGGCGGAGGG + Intronic
1141051932 16:80774392-80774414 GGGTGGGGGAGGATGGGGGAAGG + Intronic
1141177140 16:81728523-81728545 GAGGGAGGGAGGAGGGAGGAAGG - Intergenic
1141343103 16:83221641-83221663 GAGTGGGGGAGGAAGACGGTGGG + Intronic
1141651794 16:85396752-85396774 GAGTGGGTGAGGGTGGCGGCAGG + Intergenic
1141760583 16:86026240-86026262 CAGTGGGGGAGGCAGGCAGAGGG + Intergenic
1142509650 17:385814-385836 GGGTGGGGGAGGGCGGCGCCGGG - Intronic
1142598110 17:1039464-1039486 GGGTGGGGGAAGTCGGGGGAGGG - Intronic
1142759536 17:2034773-2034795 GAGTGGGGGAGGAGGGGAGGGGG - Intronic
1142958270 17:3535525-3535547 GAGTCTGGGAGGAGGGAGGAGGG - Intronic
1143473428 17:7190370-7190392 GTGTGGGAGAGGATGGGGGAGGG + Exonic
1143541883 17:7573807-7573829 GAGTGGGGGAGGGCGCGGGCGGG + Intronic
1143617754 17:8064036-8064058 GAGGCGGGGAGGCCGGCGGGGGG - Intergenic
1143714769 17:8758866-8758888 GAGAGAGGGAGGAAGGTGGAAGG + Intergenic
1144365686 17:14542053-14542075 GAGTAGGGGAGGAAAGGGGAAGG - Intergenic
1145765473 17:27456143-27456165 GGGTGGGGGACGGAGGCGGACGG + Intergenic
1145937498 17:28723498-28723520 GACTGGAGGAGGAAGGGGGAGGG + Intronic
1146178032 17:30679398-30679420 GAGTTGGGGAGGACAGAGGAGGG + Intergenic
1146178090 17:30679544-30679566 GAGGGGGGGAGGACAGAGGAGGG + Intergenic
1146178120 17:30679623-30679645 GACGGGGGGAGGACAGAGGAGGG + Intergenic
1146178143 17:30679685-30679707 GAGGGGGGGAGGACAGAGGAGGG + Intergenic
1146688313 17:34856576-34856598 GGGTGGGGGAGGACGGAGGGTGG + Intergenic
1146790410 17:35747703-35747725 GTGTGGGGGAGGCTGGAGGAAGG - Intronic
1147115585 17:38297005-38297027 GAGTGGGGGAGGGTGGAGTAAGG - Exonic
1147153930 17:38533758-38533780 GGGTGGGGGAGGGCAGGGGAGGG + Intronic
1147168219 17:38604541-38604563 TGGTGGGAGAGGACGGCGGAGGG - Intronic
1147374591 17:40016160-40016182 GAGTCGGGGAGGACCCGGGAAGG + Intronic
1147579138 17:41618695-41618717 GAGTGGGGGGGCACTGCAGATGG - Intergenic
1147970999 17:44219124-44219146 GAGGGCGGGAGGACGGCGGCCGG + Intronic
1148027727 17:44600140-44600162 GGCTGGGGGAGGAAGGGGGAGGG - Intergenic
1148070703 17:44907031-44907053 GAGAAGGGGAGGAGGGCGGGGGG - Intronic
1148233504 17:45951924-45951946 GAGAGAGGGAGGAAGGCTGATGG + Intronic
1148414097 17:47492616-47492638 GAGTGGGGGAGGGTGGAGTAAGG + Intergenic
1148431916 17:47649893-47649915 GAGGGAGGGAGGAAGGCGGAGGG - Exonic
1148796995 17:50201775-50201797 GAGAGGGGGAGGAGGAGGGAAGG + Intergenic
1148960068 17:51385361-51385383 GTGAGGGGAAGGATGGCGGATGG - Intergenic
1149294452 17:55249334-55249356 GAGTGGGGAAGGAATGAGGAAGG - Intergenic
1151241681 17:72763166-72763188 GAGAAGGGGAGGAAGGTGGAGGG - Intronic
1151276548 17:73038773-73038795 GAGGGAGGGAGGAGGGAGGAGGG + Intronic
1152045940 17:77935746-77935768 AAGTGGGGCAGGGCGGGGGAGGG + Intergenic
1152179002 17:78806210-78806232 GGGTGGGTGAGGTCGGAGGATGG + Exonic
1152362350 17:79838714-79838736 GAGCCGGGGAGGCCGGCGGAGGG - Intronic
1152710509 17:81868689-81868711 GGGTGGGGGAGGGCTGAGGAGGG + Exonic
1152761326 17:82108624-82108646 GACTTGGGAAGGACAGCGGAAGG - Intronic
1152859086 17:82685222-82685244 GGGGGAGGGAGGACGGAGGAGGG + Intronic
1152894044 17:82900188-82900210 GGGTGGGGGAGGACCGAGGCGGG - Intronic
1153330379 18:3867470-3867492 GGGTGGGGAAGGAAGGAGGAGGG + Intronic
1155257930 18:24014705-24014727 GAGGAGGGAAGGACCGCGGAGGG - Exonic
1155537312 18:26830784-26830806 GAGTGGAGGAGTAGGGCAGAAGG + Intergenic
1156104865 18:33647860-33647882 GAGTGGGGGAGTAGGGGAGAGGG + Intronic
1156826363 18:41434524-41434546 GAGGGGGGGAGGAAGTGGGAGGG + Intergenic
1156865369 18:41883459-41883481 GAGTGGGGATGGAAAGCGGAAGG + Intergenic
1157620801 18:49016595-49016617 GGGTGGGGGAAGACTGAGGAGGG + Intergenic
1157625205 18:49045173-49045195 GGGAGGAGGAGGACGGTGGAAGG + Intronic
1157867309 18:51197544-51197566 GGGTGGGTGGGGACGGCGGCGGG + Intronic
1157914750 18:51654421-51654443 CAGTGCGGCAGGAAGGCGGAAGG - Intergenic
1157944775 18:51967046-51967068 GAGTGAGGGGGGAGGGGGGAGGG - Intergenic
1158058722 18:53312983-53313005 GAGGGAGGGAGGAGGGAGGAAGG + Intronic
1158062831 18:53366810-53366832 GAGTGGGCAAGGCCGGAGGATGG - Intronic
1158435493 18:57432977-57432999 GAGTGAGGGAGGAGGGAGGGAGG + Intergenic
1158610475 18:58935407-58935429 GAGTGGGGGAGGAGGGAGAGGGG - Intronic
1159325792 18:66915400-66915422 TAGTTGGGGAGGAGGGTGGAGGG + Intergenic
1160122495 18:76143354-76143376 GAGTGGAGGGAGACGGCAGATGG + Intergenic
1160403919 18:78631462-78631484 GATTGGGGGAGGAGGGGGTAAGG - Intergenic
1160409749 18:78667731-78667753 GAGAGGGGTGGGAGGGCGGATGG - Intergenic
1160798583 19:956808-956830 GAGAGGGGCAGGACGGCTGCAGG + Intronic
1160872273 19:1282741-1282763 GAGCTGGGGAGGAGGGAGGAGGG + Intergenic
1160916844 19:1500815-1500837 GAGAAGGGGAGGAGGGAGGAGGG + Intergenic
1160916851 19:1500830-1500852 GAGGAGGGGAGGAGGGAGGAGGG + Intergenic
1160922434 19:1527164-1527186 GTGTGAGGGAGGACGGGGGAGGG + Intronic
1161007006 19:1941858-1941880 GGGTGGGGGAAGAAGGCGGGAGG - Intronic
1161400760 19:4065619-4065641 GCGTGGGGGAGGCGGGCGGGCGG - Intronic
1161614603 19:5263052-5263074 GAGGAGGGGAGGGCGGGGGAGGG + Intronic
1161989029 19:7673485-7673507 GAGGGAGGGAGGAGGGAGGAGGG - Intergenic
1162019526 19:7862355-7862377 GAGGAAGGGAGGACGGAGGACGG - Intronic
1162237708 19:9321729-9321751 GAGTGGGGGAGGAGGGTGGCAGG - Intergenic
1162237723 19:9321765-9321787 GTGGGGGGGAGGAGGGCGGGGGG - Intergenic
1162949487 19:14062073-14062095 GAGTGGGGGGGGGCTGCGGGCGG + Intergenic
1163144117 19:15369315-15369337 GCGGGGGGGAGGACCGCAGAGGG + Intronic
1163350543 19:16774070-16774092 GTGGGTGGGAGGACGGTGGATGG - Intronic
1163458156 19:17420683-17420705 GAGCGGGGGAGGAGGGACGACGG + Intronic
1164392714 19:27839883-27839905 GGGTAGGGGAGGAAGGGGGAGGG - Intergenic
1164441096 19:28281617-28281639 GTGTGGGGAAGGAAGGCGGTAGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164925600 19:32127678-32127700 GAGGGAGGGAGGAAGGGGGAGGG + Intergenic
1164998715 19:32743352-32743374 GAGTGGGGGAGGGGAGGGGAGGG - Intronic
1164998734 19:32743389-32743411 GAGCAGGGGAGGAGAGCGGAGGG - Intronic
1165069760 19:33248516-33248538 GAGAGGGAGAGGAGGGAGGATGG + Intergenic
1165845088 19:38812932-38812954 GAGTGGGAGATGGTGGCGGATGG + Exonic
1166392894 19:42419698-42419720 GGGTGGGGGTGGATGGGGGATGG + Intronic
1166551040 19:43666477-43666499 GAGGGAGGGAGGAGGGAGGAAGG - Intronic
1166876680 19:45901927-45901949 GAGTGGGGGCGGGGGGCGGGCGG + Intronic
1166975322 19:46602031-46602053 GGGTGGGGGAGGGTGGGGGAGGG + Intronic
1167072263 19:47228062-47228084 AAGTGGGAGAGGACGGGGGGAGG - Intronic
1167295332 19:48646191-48646213 GGGAGGGGGAGGAGGGAGGAAGG - Exonic
1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG + Intronic
1168123332 19:54267360-54267382 GAGTGGGGGAGGGAGGGGGAGGG + Intronic
1168249432 19:55133332-55133354 GAGAGGGAGAGGAGGGAGGAAGG + Intronic
1168352943 19:55686829-55686851 GGGTTGGGGTGGACGGAGGAGGG + Intronic
1168452711 19:56478223-56478245 GAGGAGGGGCGGACAGCGGAAGG + Intergenic
1168536729 19:57176997-57177019 GAGTGGGGAAAGAAGGCTGAAGG - Intergenic
925149580 2:1606033-1606055 GTGTGGGAGGGGACGGCCGAGGG + Intergenic
925501638 2:4511766-4511788 GAGAGGGGGAGGTCTGGGGATGG - Intergenic
926025327 2:9537926-9537948 GAGAGGGGGAGGAGAGGGGAAGG + Intronic
926145881 2:10396951-10396973 GGGTGGGTGAGGACTGAGGATGG + Intronic
927506172 2:23616170-23616192 GAGTGTGGGAGGACAGGGTAAGG - Intronic
928491763 2:31791672-31791694 TAGTGGGGGAGGTTGGGGGATGG + Intergenic
929434093 2:41914118-41914140 GAGTGGAGGAGGATGGGGGTGGG - Intergenic
929558057 2:42937686-42937708 TGGTGGGGGAGGAGGGCGGGAGG - Intergenic
930088285 2:47513910-47513932 GAGTGGAGGAGGAAAGCAGATGG - Intronic
930136154 2:47905807-47905829 GAGTGGGAGAGGGGGGAGGAAGG + Intergenic
932136173 2:69230948-69230970 GAGTGGGGAAGGTAGGAGGAGGG - Intronic
932346795 2:71001053-71001075 GAGTGGGTGAAGACAGTGGAGGG - Intergenic
932412002 2:71553142-71553164 GAGTGGTGGAGGCCAGCGGCAGG - Exonic
933679118 2:85083319-85083341 GAGGGAGGGAGGAGGGAGGAAGG + Intergenic
935308461 2:101759765-101759787 GAGGGGGAGAGGATGGGGGAAGG - Intronic
935313454 2:101807766-101807788 GAGTGGGGGAGGGGGAGGGAAGG + Intronic
935330549 2:101974449-101974471 GATTGGGGGAAGACAGGGGAAGG + Intergenic
935592926 2:104857170-104857192 GTGGAGGGGAGGGCGGCGGATGG - Exonic
936538483 2:113330746-113330768 GAGTGAGGGAGTACAGTGGAAGG - Intergenic
936881067 2:117251548-117251570 GGGTGGGGGTGGACAGCGAATGG - Intergenic
937983572 2:127628571-127628593 GGGTGGGGGAGGGCCGCGCATGG + Intronic
938218194 2:129541051-129541073 GTGGGGGGGAGGAGGGGGGAGGG + Intergenic
938301508 2:130217527-130217549 GAGCGGGGGACGGGGGCGGAGGG - Intergenic
939991245 2:148877723-148877745 GGATGGGGGAGGAGGGAGGAGGG - Intronic
940692570 2:156937500-156937522 GAGGGAGGGAGGAAGGAGGAAGG + Intergenic
941927224 2:170908294-170908316 GAGTGGGGGAAGAGCGGGGAGGG + Intergenic
942331334 2:174827895-174827917 GAGGTGGGGAGGACTGTGGAAGG + Intronic
942450746 2:176106874-176106896 AAGAGGGGGAGGAAGGGGGAAGG - Intronic
943769916 2:191705223-191705245 GAGTGGGAGAGGAAGGTGGTGGG + Intergenic
946247757 2:218397131-218397153 TTGTGGGGCAGGACGGGGGACGG + Intergenic
946385917 2:219384470-219384492 GAGTGGGGGTGGAGGGTTGAAGG - Intronic
946427667 2:219608153-219608175 TAGTGGGGGTGGCCGGCAGAGGG - Exonic
946452099 2:219789078-219789100 GAGTGGGGAGGGAAGGAGGAAGG - Intergenic
947665118 2:231900620-231900642 GAATGGGCGTGGACGGCAGAAGG - Intergenic
947670604 2:231933365-231933387 GAGCCGGGGAGGGCGGGGGAAGG + Intergenic
947994719 2:234517405-234517427 GTGGGCGGGAGGACTGCGGAGGG + Intergenic
948179324 2:235967117-235967139 GGGTGGGAGAGGCCTGCGGAAGG - Intronic
948564645 2:238876131-238876153 GGGTGTGGGTGGAGGGCGGATGG + Intronic
948635061 2:239329514-239329536 GAATGGGGGAGCAAGGAGGAGGG - Intronic
948635150 2:239329947-239329969 GAATGGGGGAGCAAGGAGGAGGG + Intronic
948871955 2:240805113-240805135 GAGAGGGGAGGGAGGGCGGAGGG + Intronic
1168891253 20:1296456-1296478 GAGGGCGGGAGGAGGGCGCACGG + Intronic
1169002376 20:2177373-2177395 GAGTGGGGCAGGAGGGCACAGGG - Intergenic
1169018000 20:2307331-2307353 GGTTGGGGCAGGACTGCGGAGGG - Intronic
1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG + Intronic
1169155628 20:3327364-3327386 GAGTGGGGAAAGATGGGGGAGGG + Intronic
1169324078 20:4661173-4661195 GAGGGAGGGAGGGCGGGGGAGGG + Intergenic
1169791364 20:9413863-9413885 GAGGGGTGGAGGAGGGAGGATGG - Intronic
1170614750 20:17939512-17939534 GAGTGGGGGAGGGCGGGGAGAGG + Intergenic
1170788920 20:19491734-19491756 GAGTGGGAGAGGAAAGAGGAAGG + Intronic
1171208953 20:23302426-23302448 GAGTGGGGGCGGGGGGCGGCAGG - Intergenic
1172101183 20:32484478-32484500 GGGGCGGGGAGGAGGGCGGAGGG - Intronic
1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG + Intronic
1172474687 20:35227385-35227407 GGGAGGGGGAGGGCGGAGGAAGG + Intronic
1172656691 20:36542152-36542174 GGGTGGGGAAGGTCTGCGGAGGG + Intronic
1172773392 20:37394149-37394171 GGGGGTGGGAGGACGGAGGATGG - Intronic
1172858735 20:38030222-38030244 GAGGGAGGGAGGAGGGAGGAAGG + Intronic
1173225105 20:41157966-41157988 GACTGGGGAAGGATGGCTGATGG + Intronic
1173438846 20:43057305-43057327 GAATGGAGGAGGAGGGGGGAAGG + Intronic
1173517643 20:43676255-43676277 GAGGGTGGGAGGAGGGTGGAGGG - Intronic
1173541682 20:43857346-43857368 GAGAGAGGGAGGAGGGAGGAAGG + Intergenic
1173631618 20:44520602-44520624 GAGTGGGGAAGGACGGTGGGGGG + Intronic
1173719010 20:45237042-45237064 GAGTGGGGGTGGGGGGCGGATGG - Intergenic
1173792141 20:45834471-45834493 GAGTGCAGGAGGACGGAGGCGGG + Intronic
1174177334 20:48653297-48653319 GAGTGGGGGTGGGTGGCTGAGGG - Intronic
1174191144 20:48741686-48741708 GAGTAGGGGAGGGGCGCGGAAGG + Intronic
1174518681 20:51113255-51113277 GAGGGAGGGAGGAAGGCGGGCGG - Intergenic
1174804492 20:53593862-53593884 GAGGGGGCGGGGAGGGCGGAGGG + Intronic
1174870143 20:54174110-54174132 GAGGGGGGGTGGAAGGAGGATGG + Intergenic
1175224932 20:57439342-57439364 GAGTGGGGTGGCACGGCAGAGGG - Intergenic
1175402976 20:58711103-58711125 GAGAGGGGGAGGAGGGGGGGAGG - Intronic
1175672821 20:60920670-60920692 GTGTGTGTGAGGACTGCGGAGGG - Intergenic
1175891614 20:62318316-62318338 GAGGGGGGGAGGACGAGGGAGGG + Intronic
1175984187 20:62755803-62755825 GAGGGAGGGAGGATGGCTGAAGG - Intronic
1176105500 20:63384016-63384038 CACTGGGGGAGGACGGTGCATGG - Intergenic
1176270476 20:64233365-64233387 GAGTGGGGGAGGTGGGGGGTGGG - Intronic
1177664826 21:24141176-24141198 GAGTGGGGAGGGAAGGAGGAGGG + Intergenic
1178824678 21:36005053-36005075 GAGTCGGGGGGGCCGGGGGAAGG + Intergenic
1179043997 21:37829216-37829238 GATTGTGGGAGGAGGGCGGGAGG + Intronic
1179084983 21:38207958-38207980 GAGTGGAGGAGGAGAGAGGAGGG - Intronic
1180155496 21:45975349-45975371 CAGTGAGGGTGGACGGCGGAGGG - Intergenic
1180235671 21:46458295-46458317 GAGGGCGGGAGGACGGACGAGGG - Intergenic
1180597980 22:16991688-16991710 GAGAGGTGGAGGACTGAGGATGG + Intronic
1180655655 22:17418760-17418782 GAGAGAGGGAGGACGGGAGAGGG + Intronic
1180818432 22:18807971-18807993 AAGTGGGGGAGGGGGGCTGATGG + Intergenic
1180947413 22:19704127-19704149 GGGTGGGGCAGGAAGGAGGAAGG + Intergenic
1181204654 22:21242426-21242448 AAGTGGGGGAGGGGGGCTGATGG + Intergenic
1181387817 22:22558141-22558163 CAGTGGGGGGGGATGGAGGAAGG + Intronic
1181852993 22:25763251-25763273 GAGGGGGCGAGGATGGTGGAGGG - Exonic
1182243178 22:28933784-28933806 GGGAGGGGGAGGAGGGAGGAGGG - Intronic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182709190 22:32310061-32310083 GGGGGAGGGAGGACGGGGGATGG + Intergenic
1182866103 22:33606029-33606051 GAGTGGGGGCCGGGGGCGGAGGG + Intronic
1183358343 22:37371156-37371178 GGGTGAGGGAGGACAGCAGAGGG - Exonic
1183437288 22:37803463-37803485 GATTAGGGGAGGAAGGGGGAGGG - Intergenic
1183535517 22:38398544-38398566 GAGGGGGCGGGGAGGGCGGAGGG + Intergenic
1183675457 22:39296861-39296883 GGCTGGGGGAGAACGGGGGATGG - Intergenic
1184485291 22:44774833-44774855 GGGTGGGGGCGGGGGGCGGATGG + Intronic
1184492016 22:44815242-44815264 GTGTGGGGGAGGAGGGAGCATGG + Intronic
1185033915 22:48460882-48460904 GGGTGGGGGAGGACTGCGGGAGG + Intergenic
1185108028 22:48885350-48885372 GAGTGTGGGAGGACGGGAGGAGG - Intergenic
1185110135 22:48896206-48896228 GGGTGAGGGAGGAGGGAGGATGG + Intergenic
1203222270 22_KI270731v1_random:52989-53011 AAGTGGGGGAGGGGGGCTGATGG - Intergenic
949533112 3:4977002-4977024 GGGTGGGGGGTGTCGGCGGAAGG + Intergenic
949634771 3:5970618-5970640 GAGTGGGGGAGAAGGGAAGAAGG - Intergenic
949863991 3:8532392-8532414 GAGTGGGTGAGGGTGGGGGATGG + Intronic
950940404 3:16885131-16885153 GAGTGGGGGAAGGCGGTGGCGGG + Intronic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951620229 3:24593600-24593622 GAGGTGGGGAGGAGGGGGGAGGG - Intergenic
952107578 3:30087718-30087740 GAGGGAGGGAGGAGGACGGAGGG - Intergenic
954349952 3:50035032-50035054 GAGTAGGGGAGGAGAGGGGAGGG - Intronic
954787329 3:53103617-53103639 GGGTGAGGGAGGAAGGCAGAGGG - Intronic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
955203379 3:56873369-56873391 GAGCGGGGGAGAAGGGAGGAGGG - Intronic
955516568 3:59731885-59731907 GAGTGGTGAATGACGGCAGAAGG + Intergenic
956061619 3:65353745-65353767 AAGTGGGGGAGGGGGGCGGCGGG + Intronic
956167729 3:66408970-66408992 GAGGGGGGGAGGAGGAGGGAAGG + Intronic
956178204 3:66494004-66494026 GAGTGGGGGAGGGAAGGGGAAGG + Intronic
956481068 3:69674525-69674547 GAGTGGTGGGGGCCGGCGTAAGG - Intergenic
956657699 3:71568062-71568084 GAGGGGGGGAGGAGAGGGGAGGG + Intronic
956781508 3:72606669-72606691 GACTGGGGTAGGAGGGAGGAGGG + Intergenic
958732586 3:97974516-97974538 GAGGGAGGGAGGAAGGGGGAGGG + Intergenic
959082863 3:101820872-101820894 GAGTGGGGGAGTTGGGAGGAAGG + Intronic
960719246 3:120609579-120609601 GAGGGAGGGAGGAGGGTGGAGGG - Intergenic
961013203 3:123449149-123449171 GAGGTGGAGAGGACGGGGGAGGG + Exonic
961345261 3:126260041-126260063 GAGGAGGGGAGGAGGGAGGAGGG - Intergenic
961441862 3:126958144-126958166 GGGTGGGGGAGGAAGGCAGTAGG - Intronic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961612578 3:128152915-128152937 GAGGGCGGGGGGACGGCGGGGGG - Intronic
963256797 3:143152998-143153020 GACTGGGGCAGGAGGGAGGAGGG - Intergenic
965262024 3:166499440-166499462 GAGGGTGGAAGGACGGAGGAAGG - Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
967401598 3:189068804-189068826 GAGGGAGGGAGGAGGGAGGAGGG + Intronic
967478628 3:189949336-189949358 GAGTGGGGGAGGGGAGGGGAGGG - Intergenic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
968005226 3:195238140-195238162 GAGGCGGGGAGGTCGGGGGACGG - Intronic
968746909 4:2365022-2365044 AAGTGGGGGAGGGAGGTGGAGGG + Intronic
968961393 4:3746022-3746044 GAGTGGGGGAGGGGCGGGGAGGG + Intergenic
968985380 4:3871878-3871900 GGGAGGGGAAGGACGGCGGCGGG + Intergenic
969146764 4:5130772-5130794 GAGTGGGGCAGGGTGGAGGAAGG - Intronic
969156155 4:5211569-5211591 GACTAGGGGAGGAGGGGGGATGG + Intronic
969294897 4:6263988-6264010 AAGTGGGAGAGGACGAAGGAGGG + Intergenic
972285341 4:37642775-37642797 GAGCAGGGGAGGACGGGGCAGGG + Intronic
972369313 4:38407455-38407477 AAGTTGGGGAAGAAGGCGGAAGG - Intergenic
972433094 4:39002883-39002905 GTGGGGGGGTGGACGGGGGAGGG + Intronic
972445983 4:39144383-39144405 GAAAGGGGGAGGAGGGTGGAAGG - Intergenic
972466879 4:39366133-39366155 GGGTGGGGGAGGATGGCGGTGGG - Intronic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974351697 4:60755843-60755865 CAGTGGGGGAGGAAGGAGGTGGG + Intergenic
977694455 4:99950468-99950490 GAGAGGCGGGGGAAGGCGGAGGG + Intergenic
977918380 4:102618153-102618175 GGGTGGGGGGGGAGGGGGGAGGG + Intergenic
978297283 4:107220570-107220592 GAGTGGGGAAGGAGGGAGGGAGG + Intronic
978702329 4:111662629-111662651 GGGAGGGGGAGGAGGGAGGATGG + Intergenic
979046042 4:115866484-115866506 GAGTGAGGAAGGAAGGAGGAAGG + Intergenic
980531452 4:134060937-134060959 GAGTGAGGGAGGATGTCAGATGG + Intergenic
980990555 4:139735390-139735412 AAGTGGGGGAGGGCGCGGGAAGG + Intronic
981629410 4:146801090-146801112 GAGTGGCAGAGGACAGGGGAGGG + Intronic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
982868459 4:160546694-160546716 GAGAGGAGGAGGAAGGCAGATGG - Intergenic
983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG + Exonic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985358730 4:189148933-189148955 GAATTTGGGAGGATGGCGGATGG + Intergenic
985462016 4:190116615-190116637 GGGTGGGGGGGGAGGGGGGAGGG - Intergenic
985537911 5:474892-474914 GACTCGGGGAGGGCGGCGGGGGG + Exonic
985749706 5:1667283-1667305 GAGGGGGGGAGGGGGGAGGAGGG - Intergenic
986636479 5:9827154-9827176 GACTGGAGGAGGAAGGAGGAAGG - Intergenic
986806378 5:11312160-11312182 GTGTGGGGGATGACGGTGTATGG - Intronic
987370032 5:17184782-17184804 GAGTGGTGGGAGACGGGGGAGGG - Intronic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
989824069 5:45832984-45833006 GTGGGGGGGAGGATGGGGGAGGG - Intergenic
990275522 5:54191957-54191979 GAGTGGGGGAGGAAGGAGGAAGG - Intronic
991483001 5:67103509-67103531 GAGGGGAGGAGGAGGGAGGAAGG + Intronic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
992526358 5:77614648-77614670 GGGTGGGGGGGGAGGGGGGAGGG + Intronic
993168459 5:84385021-84385043 GAGGAGGGGAGGAGGGAGGAAGG - Intergenic
993536928 5:89098430-89098452 GAGTGGGGGAGGGATGGGGAGGG - Intergenic
994055555 5:95410261-95410283 GAGTGGGCCAGGAAGCCGGAAGG + Intronic
994100115 5:95882593-95882615 GGGTGGGGGTGGGGGGCGGATGG + Intergenic
994140929 5:96340337-96340359 GAGTGGGGGTTGAGGGCAGAAGG - Intergenic
995039417 5:107571137-107571159 GAGTGGGGGAAGAGGGCTTAGGG + Intronic
995402328 5:111757244-111757266 GATTGGGGGAGGGAGGGGGAGGG + Intronic
995575658 5:113530247-113530269 GGGTAGGGGAGGTCGGGGGAAGG - Intronic
996744712 5:126836889-126836911 GGGTGGGGGAGGGAGGTGGAGGG + Exonic
997410067 5:133684277-133684299 GGGTCGGGGAGGACAGAGGAAGG - Intergenic
998394817 5:141811778-141811800 GAGTCGGGGAGGGCGGCGACTGG + Intergenic
999329398 5:150662375-150662397 GAGATGGGGAGGACGGGGGATGG + Intronic
1000371530 5:160541103-160541125 GAATAGAGGAGGACGGCCGAGGG + Intergenic
1000990151 5:167903529-167903551 GGGTGGGGGTGGAGGGTGGAAGG + Intronic
1001132886 5:169079477-169079499 GGGTGGGGGAGGAGGGGGGGAGG + Intronic
1001254897 5:170176009-170176031 AAGTGGGGGAGGAAGACTGAGGG - Intergenic
1001581992 5:172805327-172805349 GAGTGAGAGAGGACGAAGGAAGG + Intergenic
1001701371 5:173708945-173708967 GAGTGGGTGAGGATGGAGGCCGG - Intergenic
1002042293 5:176523503-176523525 GAGGAGGGGAGGAGGGGGGAGGG - Intergenic
1002180650 5:177429403-177429425 GAGGGTGGGAGGCTGGCGGATGG + Intronic
1002187331 5:177460396-177460418 GAGTGGGGCCGGACGGGGGGTGG + Intronic
1002304972 5:178277907-178277929 GGGTGAGGGAGGATGGAGGATGG + Intronic
1002355458 5:178625816-178625838 GAGTGGGGGAGGTCAGAGGCTGG - Intronic
1002355873 5:178627989-178628011 TCGTGGGGGGGGACGGCGGGCGG + Intronic
1004882449 6:20022515-20022537 GAGCGGGGGAGGATGAGGGAAGG - Intergenic
1005081912 6:21965276-21965298 GAGGAGGGGAGGAAGGAGGAGGG - Intergenic
1005081918 6:21965291-21965313 GAGGAGGGGAGGAAGGAGGAGGG - Intergenic
1005277181 6:24231560-24231582 TAGTGGTGGAGGATGGGGGAGGG - Intronic
1005685283 6:28247972-28247994 GGGTGGGGTAGGACTGGGGAGGG + Intronic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006187711 6:32190182-32190204 GAGAGAGGGAGGAGGGAGGAGGG + Exonic
1006320708 6:33317742-33317764 GAGCGGAGGCGGAGGGCGGAGGG - Intronic
1006457956 6:34142805-34142827 GGTTGGGGGAGGAGGGAGGAGGG + Intronic
1006814158 6:36839531-36839553 GAGAGAGGGAAGAGGGCGGAGGG + Exonic
1006903654 6:37518764-37518786 GAGTTGGGGAGTTCGGCGGGGGG - Intergenic
1007377475 6:41466667-41466689 GAAGGGGGGAGGAAGGAGGAAGG + Intergenic
1007521090 6:42452252-42452274 AAGAGGGGGAGGGCGGGGGAAGG + Intergenic
1007521305 6:42453072-42453094 GAGAGGGGCCGGGCGGCGGAGGG + Intergenic
1007953763 6:45897428-45897450 GGGTGGGGGAGTAGGGAGGAGGG + Intergenic
1008920934 6:56843696-56843718 GAGGGAGGGAGGAGGGTGGAGGG + Intronic
1009826691 6:68875214-68875236 GAGGGGGAGAGGAAGGGGGAAGG - Intronic
1011406729 6:87022932-87022954 AAGTGGGGGAGGGAGGGGGAGGG + Intergenic
1011632383 6:89339638-89339660 GAGTGGGGGAGGGGAGGGGAGGG + Intronic
1011713249 6:90076739-90076761 GAATGAGGGATGAAGGCGGATGG - Intronic
1012156509 6:95825762-95825784 GAGTGTGGGAGGTGGGAGGAGGG + Intergenic
1012398970 6:98828865-98828887 GTGTCCGGGAGGACGGCGGTTGG - Intergenic
1013123268 6:107159294-107159316 GAGGGAGGGAGGGAGGCGGAAGG + Intronic
1014214388 6:118738726-118738748 GAGTGGAGGAGGAGGGGGAAAGG - Intergenic
1014494388 6:122102339-122102361 AAGTGGGGGAGGAGGAAGGAAGG + Intergenic
1014913291 6:127118569-127118591 GAGGGGGAGAGGAGGGGGGATGG - Intergenic
1015011578 6:128355646-128355668 TGGGGTGGGAGGACGGCGGAGGG + Intronic
1015594203 6:134850774-134850796 GGGTGAGAGGGGACGGCGGAAGG - Intergenic
1016013940 6:139165333-139165355 CAGTGGGGGAGGCTGGAGGAGGG - Intronic
1017637303 6:156456075-156456097 GAGTGGAGGAGGGGGGAGGAGGG - Intergenic
1017768766 6:157628667-157628689 GAGTGGGGGATGACAGGGGACGG - Intronic
1017869846 6:158478098-158478120 GAGAGTGGGAGGAGGGAGGAGGG + Intronic
1018722973 6:166587905-166587927 GAGTGAGTGAGGAGGGCGCAGGG - Intronic
1018753508 6:166828308-166828330 GAGTTGGGGAGGAAGGGGAAAGG - Intronic
1018910312 6:168097795-168097817 GACTGGGGGTGGACAGCGGAGGG - Intergenic
1018985909 6:168636983-168637005 GAGTGAGGGAGGCGGGAGGAGGG - Intronic
1019455467 7:1124563-1124585 GGGTGGGGGGGGAGGGGGGAGGG + Intronic
1019517740 7:1447195-1447217 GAGTTGGGGTGGAAGGCGGTGGG - Intronic
1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG + Intronic
1021904755 7:25322247-25322269 GAGTTGGGGAGGTGGGGGGAGGG + Intergenic
1022027743 7:26464644-26464666 GAGGAGGGGAGGATGGGGGACGG + Intergenic
1022476748 7:30716036-30716058 GAGAGGAGGAGGACGCCTGAGGG - Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023843419 7:44108781-44108803 GAGGGGAGGAGGACGGGAGATGG - Intronic
1023910042 7:44547281-44547303 GAGAGGGGGAGGGAGGGGGAAGG + Intergenic
1025709024 7:63890868-63890890 GAGAGGAGGAGGAGGGCTGAAGG + Intergenic
1025911476 7:65832260-65832282 GAGGGAGGGAGGACAGGGGAGGG + Intergenic
1026011880 7:66642809-66642831 GAGTGGGGAAGGATGGGGGTTGG + Exonic
1026630260 7:72031984-72032006 GGGAGGTGGAGGAGGGCGGACGG - Intronic
1027297546 7:76793249-76793271 GAGGGGTGGAGGAGGGCTGAAGG - Intergenic
1027407101 7:77873324-77873346 GGGTGTGGGATAACGGCGGAAGG - Intronic
1028297807 7:89156926-89156948 CAGTGAGGGAGGAAGGAGGAGGG + Intronic
1028622181 7:92836628-92836650 GAGGGCGGAGGGACGGCGGAGGG + Intergenic
1029232376 7:99081092-99081114 GAGTGGAGAAGGATGGCGCAGGG + Intronic
1029640208 7:101815749-101815771 GGGAGGGGGAGGGCGGCGGTGGG + Intergenic
1031051559 7:116950633-116950655 GAGGGAGGGAGGAGGGAGGAGGG - Intergenic
1032339117 7:131054534-131054556 GAGGGAGGGAGGAGGGAGGAAGG + Intergenic
1032396393 7:131592982-131593004 GAGGGGAGGAGGGCGCCGGAGGG + Intergenic
1032839583 7:135703498-135703520 GAGAGGGAGAGGGTGGCGGAGGG + Intronic
1034117480 7:148596807-148596829 GAGTGGGGGAGGAAGGGAGTGGG - Intronic
1034223317 7:149461497-149461519 AAGTGAGGGAAGACGGCGGGGGG + Intergenic
1034269113 7:149795161-149795183 GAGTAGGGGAGGACAGAGGGCGG - Intergenic
1034306690 7:150049218-150049240 GAGCCGGGGAGGACGCGGGAGGG - Intergenic
1034800155 7:154051425-154051447 GAGCCGGGGAGGACGCGGGAGGG + Intronic
1034977618 7:155457622-155457644 GAGGCGGCGAGGGCGGCGGACGG + Intergenic
1035404166 7:158587533-158587555 GAGTGGGGGGCGCCGGGGGAGGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035732058 8:1860318-1860340 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1035732080 8:1860385-1860407 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1035901061 8:3459069-3459091 GTGTGGGGGAGAACGATGGATGG + Intronic
1036546189 8:9771798-9771820 AAGTGGGGGAGGAAGGGAGAAGG + Intronic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1037584736 8:20268691-20268713 GAGTGGAGGAGGAAGGGGGTGGG + Intronic
1037796275 8:21997843-21997865 GTGGGGGGGAGGAAGGAGGAAGG + Intronic
1037876695 8:22552048-22552070 GAGTAGGCGAGGCCGGCGGGAGG + Intronic
1038055790 8:23856297-23856319 GGGGGGGGGGGGGCGGCGGACGG + Intergenic
1039125012 8:34191746-34191768 GAGAGGGGGAGGGGAGCGGAGGG - Intergenic
1039428459 8:37506272-37506294 GAGGGGGGGAGGAAGAAGGAAGG + Intergenic
1039488008 8:37927059-37927081 GAGAGGGGGAGGGAGGGGGAGGG - Intergenic
1039772678 8:40703577-40703599 CAGTGGGGGAGCAGGGAGGAGGG + Intronic
1043835129 8:85036816-85036838 GAGGGAGGGAGGAGGGCGGAGGG + Intergenic
1044300007 8:90572807-90572829 GAGGGAGGGAGGATGGGGGAGGG + Intergenic
1044873950 8:96645692-96645714 GTGTTGGGAAGGACGGCTGAGGG - Intronic
1045305218 8:100951938-100951960 GAGTGGGTGGTGGCGGCGGACGG + Exonic
1045488965 8:102655237-102655259 GAGCGGGGGAGGAGTGGGGAGGG - Intronic
1045710339 8:104975648-104975670 GAGTGGGGGAGGAGAGAGAAAGG - Intronic
1047826498 8:128582026-128582048 GAGGGAGGGAGGAAGGAGGAAGG - Intergenic
1047953663 8:129956805-129956827 GAGGGAGGGAGGAGGGAGGAAGG - Intronic
1048294925 8:133206978-133207000 GAGTGGAGCAGGAAGGCGGGGGG + Intronic
1048997088 8:139800970-139800992 GAGCGGGGGAAGATGCCGGAGGG - Intronic
1049109816 8:140635692-140635714 GGGCGGGGGAGGAAGGAGGAGGG + Intergenic
1049222371 8:141433935-141433957 GGGTGGGGGAGGATGGCTGGAGG + Intergenic
1049256821 8:141618624-141618646 GGGTGGGGGATGAAGGTGGATGG - Intergenic
1049334488 8:142075790-142075812 GAGTGGGGGAGGGTGGCACAAGG + Intergenic
1049370384 8:142261431-142261453 GAGAGAGGGAGGACCGGGGAGGG + Intronic
1049541700 8:143211700-143211722 GCGTGGGGGAGGCGGGCCGAGGG + Intergenic
1049718169 8:144103528-144103550 GAGTGGGGGCGGAGGGCGCGCGG - Intronic
1050090606 9:2014744-2014766 GAGAGGGAGGGGACGGGGGACGG - Intergenic
1050969128 9:11846504-11846526 GAGGGGGGGAGGGAGGGGGATGG - Intergenic
1051387544 9:16525067-16525089 GAGTGGGGGAGGGGGGGGGAAGG + Intronic
1051598588 9:18849632-18849654 GAGTGGGAAAGGAAGACGGAGGG + Intronic
1052970407 9:34373800-34373822 GAGGGGGAGAGGAGGGAGGAAGG + Intronic
1053050544 9:34958019-34958041 GAATGCGGGAGGACGGCGGACGG - Intronic
1053073000 9:35111895-35111917 GGGCGGGGGAGTAGGGCGGAGGG - Intronic
1053130157 9:35610044-35610066 GGGTGGGGGAGGAGGGCGCACGG - Exonic
1053152966 9:35754562-35754584 CAGTGGGGGAGAAAGGGGGAAGG - Exonic
1053482550 9:38426554-38426576 GAGTGGGGGAGGACGGCTTGAGG - Intergenic
1054456609 9:65434530-65434552 GGGTGGAGGAGGCTGGCGGAGGG - Intergenic
1054714840 9:68547028-68547050 GAGTGGGGGAAGAGGAGGGAGGG - Intergenic
1054821620 9:69527077-69527099 GAGTGGGGAAGGACAGAGGAGGG + Intronic
1054901150 9:70370761-70370783 GAGGGGGAGAGGAAGGGGGAGGG + Intergenic
1057172562 9:92971948-92971970 GTGTGGGGGAGGGGGGTGGATGG - Intronic
1057992222 9:99782361-99782383 GAGTGGGGGAGGGCAGGGGAGGG - Intergenic
1058227454 9:102383094-102383116 GGGTGGGGGAGGAGGGGGGAGGG - Intergenic
1058960461 9:109988553-109988575 GAGGGAGGGAGGAAGGAGGAAGG + Intronic
1059086710 9:111310889-111310911 GAGAGGGGGAGGAGGGAGGGAGG - Intergenic
1059418630 9:114177416-114177438 GTGTGGAGGAGGACTGCAGAGGG + Intronic
1059462976 9:114446895-114446917 GAGTTGGGGAGGGAGGGGGAAGG - Intronic
1059509164 9:114827970-114827992 AAGTGGGGAAGGAAGGAGGAAGG - Intergenic
1060446185 9:123690150-123690172 GAGGGAGGGAGGAAGGAGGAGGG + Intronic
1060451951 9:123750964-123750986 GAGTCGGGGAGGAAGGCTGTGGG - Intronic
1060952497 9:127612798-127612820 GAGGGGTGGAGGAAGGGGGAAGG - Intronic
1060973717 9:127753294-127753316 ATGTGGGGGAGCAGGGCGGAGGG + Intronic
1061246145 9:129402117-129402139 GAGGTGGGGAGGAGGGAGGAGGG - Intergenic
1061275565 9:129568087-129568109 GAGTGGGGAGGGACAGAGGAAGG - Intergenic
1061287232 9:129631031-129631053 GAGCGGGGGAAGACTGTGGAAGG - Intronic
1061450440 9:130664502-130664524 GAGAGGAGGAGGACGCAGGAGGG - Intergenic
1062019141 9:134308096-134308118 GAGCGGGTGAGGACCGTGGAGGG + Intergenic
1062144065 9:134979112-134979134 GAGGGAGGGAGGAGGGGGGAGGG + Intergenic
1062266675 9:135689716-135689738 GAGAGGGGGAGGCTGGCGGTGGG - Intergenic
1062294119 9:135814650-135814672 GGGTTGGGGAGGACCGAGGACGG - Intronic
1062421192 9:136483448-136483470 GGGCGGGGAAGGACGGCCGAGGG - Intronic
1185603615 X:1355019-1355041 GAGGGGGAGAGGATGGAGGAAGG + Intronic
1186496249 X:10014926-10014948 CGGAGAGGGAGGACGGCGGAGGG + Intergenic
1186523632 X:10228222-10228244 GAATGGGGGAGGGGGGAGGAGGG - Intronic
1187464421 X:19515084-19515106 GAGTGGGGGCGGGCCGCGGCGGG - Exonic
1187939863 X:24371224-24371246 GGGTGGGGGAGGACGAGAGAAGG + Intergenic
1188239864 X:27772777-27772799 GAGTGGGGAAGCACGGTGGAAGG + Intergenic
1188851761 X:35140826-35140848 GGGTGGGGGGGGAGGGGGGAGGG + Intergenic
1189532192 X:41896923-41896945 TAGTGGGGGAGGAGGGAGTAGGG - Intronic
1189891146 X:45603798-45603820 GAGTGAGGGAGGAAAGAGGAAGG - Intergenic
1190399180 X:50014588-50014610 GAGAGGGGGAGCAGGGCAGAAGG - Intronic
1191902225 X:66053361-66053383 GTGTGGGGGGGGGCGGGGGAGGG - Intergenic
1192207077 X:69103478-69103500 GAGTGGGGGTGGAGGTGGGATGG - Intergenic
1192537665 X:71942055-71942077 GAGTGGGGGTGGATGAGGGAAGG + Intergenic
1192546483 X:72018706-72018728 GGGCGGGGGAGGAGGGCGGGCGG - Intergenic
1194167032 X:90529891-90529913 GAGTGGGGGAGGAATGTGAAAGG + Intergenic
1196039736 X:111189065-111189087 GAGTGAGGAAGGAGGGAGGAGGG - Intronic
1196866927 X:120078532-120078554 GAGGGGGGGAGTAGGGCGGGGGG + Intergenic
1196876172 X:120157750-120157772 GAGGGGGGGAGTAGGGCGGGGGG - Intergenic
1197251270 X:124218466-124218488 GGATGGGGGAGGACGGGAGAAGG + Intronic
1197695013 X:129540635-129540657 GGGCGGGGGAGGGCGGCGGTGGG + Intronic
1197980712 X:132216515-132216537 GAGAAGGGGAGGGCGGCGGGAGG + Intronic
1198517572 X:137425058-137425080 GAGAGGGGGACGAGGACGGAAGG + Intergenic
1199264754 X:145817735-145817757 GAGGGAGGGAGGAGGGAGGAGGG - Intergenic
1199347839 X:146762058-146762080 GAGTGGGGGAAGACGGGAGGGGG + Intergenic
1199873316 X:151915441-151915463 GTGGGGGGGAGGTCGGTGGAGGG - Intronic
1199873843 X:151917485-151917507 GTGGGGGGGAGGTCGGTGGAGGG - Intronic
1199874021 X:151918160-151918182 GTGGGGGGGAGGTCGGTGGAGGG - Intronic
1200173828 X:154097858-154097880 GGGACGGGGAGGACGGGGGAGGG + Intergenic
1200479498 Y:3682696-3682718 GGGTGGGGGAGGACGGGAGCCGG - Intergenic
1200873306 Y:8126092-8126114 AAGTGGAGGAGGACTGAGGAAGG - Intergenic
1201699496 Y:16864756-16864778 GGGTGGGGGAGGGGGGAGGAGGG + Intergenic