ID: 1114640743

View in Genome Browser
Species Human (GRCh38)
Location 14:24218486-24218508
Sequence CTAGGTAAAACATCCTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114640739_1114640743 5 Left 1114640739 14:24218458-24218480 CCTTAAAGCCCAATGTACAATTT 0: 1
1: 0
2: 0
3: 17
4: 250
Right 1114640743 14:24218486-24218508 CTAGGTAAAACATCCTATGTTGG 0: 1
1: 0
2: 2
3: 4
4: 100
1114640740_1114640743 -3 Left 1114640740 14:24218466-24218488 CCCAATGTACAATTTGTCTTCTA 0: 1
1: 0
2: 3
3: 26
4: 265
Right 1114640743 14:24218486-24218508 CTAGGTAAAACATCCTATGTTGG 0: 1
1: 0
2: 2
3: 4
4: 100
1114640741_1114640743 -4 Left 1114640741 14:24218467-24218489 CCAATGTACAATTTGTCTTCTAG 0: 1
1: 0
2: 0
3: 22
4: 163
Right 1114640743 14:24218486-24218508 CTAGGTAAAACATCCTATGTTGG 0: 1
1: 0
2: 2
3: 4
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114640743 Original CRISPR CTAGGTAAAACATCCTATGT TGG Intronic
903083809 1:20836545-20836567 ATTGGTAAAAGACCCTATGTAGG - Intronic
904556855 1:31370908-31370930 TTAAGTAAAACAACCCATGTAGG - Intronic
909849491 1:80442407-80442429 CTAGGTATAATATCTTATATTGG - Intergenic
909863235 1:80634377-80634399 CCTGGTAAAACATCTTATGAAGG - Intergenic
910385242 1:86675378-86675400 CTAGGTACAGAATTCTATGTTGG - Intergenic
911313441 1:96326421-96326443 CTGGGTAAAATATTCTATCTGGG - Intergenic
912723678 1:112041007-112041029 CGAGATAAAACATCCTATGTTGG + Intergenic
913679753 1:121178302-121178324 CTAGCTAAAACATTCCCTGTAGG - Intronic
914031587 1:143965952-143965974 CTAGCTAAAACATTCCCTGTAGG - Intronic
914157858 1:145102013-145102035 CTAGCTAAAACATTCCCTGTAGG + Intronic
915089637 1:153415595-153415617 CTATGCAAAACAGCCTGTGTAGG - Intergenic
915095864 1:153461533-153461555 CTATGCAAAACAGCCTGTGTAGG + Intergenic
915687444 1:157648630-157648652 CTAAGTAAAAGAAACTATGTTGG - Intergenic
917390579 1:174531925-174531947 CTAGGTATAAAATTCTAGGTTGG - Intronic
917601068 1:176574459-176574481 CTAGGTAAAAAATCAAATGGTGG - Intronic
920467062 1:206196838-206196860 CTAGCTAAAACATTCCCTGTAGG - Intronic
920645398 1:207799771-207799793 CTAGGTAGAAAATGCTTTGTAGG - Intergenic
921806203 1:219458452-219458474 CTAGGAAAAAAATCCTAGGGAGG - Intergenic
1067756678 10:49010945-49010967 ATAGGCAAAACATCCTATGATGG - Intergenic
1067906631 10:50297834-50297856 CTAGGTATAGTATCCTTTGTTGG - Intergenic
1072312149 10:94166987-94167009 CTAGTTAAGATATGCTATGTGGG + Intronic
1079605906 11:22366125-22366147 ATAGGAAAAACATTATATGTAGG - Intronic
1081275743 11:41147242-41147264 CTAGGTAAAACATCCTTAGTAGG + Intronic
1082300108 11:50494685-50494707 CCAGGGGAAACATCCCATGTTGG + Intergenic
1085373795 11:76039241-76039263 CTTGGTAAAGCATCAAATGTTGG + Intronic
1086197737 11:84161252-84161274 CCAGGTAATACATGCTAGGTGGG + Intronic
1095760854 12:45834426-45834448 CTATTTAAAAAATTCTATGTTGG + Intronic
1098885192 12:75953795-75953817 CAAGGGAAAACCTCCCATGTAGG + Intergenic
1100104476 12:91152248-91152270 CTAGGTAAAATATTCTTTGATGG - Intronic
1100253318 12:92855127-92855149 TTAGTTAAAACATCCTATCACGG + Intronic
1105081307 13:16122451-16122473 ATAGTTGAAACATGCTATGTGGG + Intergenic
1105082451 13:16139583-16139605 ATAGTTGAAACATGCTATGTGGG + Intergenic
1106149921 13:27089495-27089517 GAATGTACAACATCCTATGTAGG + Intronic
1107429060 13:40322467-40322489 CAAGGTAAAACAGCCAGTGTAGG - Intergenic
1109735470 13:66478898-66478920 GTAGATAAAACAGCCTCTGTTGG + Intronic
1110696720 13:78499731-78499753 CTAGGAAAAATATCTAATGTTGG - Intergenic
1114640743 14:24218486-24218508 CTAGGTAAAACATCCTATGTTGG + Intronic
1116182856 14:41557454-41557476 CTACTCAAAACATCCTATCTAGG - Intergenic
1117140256 14:52783689-52783711 CTATTTAAAACATCTTATGCAGG - Intronic
1123964372 15:25439623-25439645 CTAGTTGACACATCCTGTGTTGG - Intergenic
1124455612 15:29839899-29839921 ATAGTGAAAACATCATATGTTGG - Intronic
1124703725 15:31941693-31941715 CTAGGTACAGAATTCTATGTTGG + Intergenic
1126410987 15:48372880-48372902 CTTGGTCAAACACCCTATGCTGG - Intergenic
1128192183 15:65712548-65712570 CTAGGAAAAACATACTACATTGG - Intronic
1140399750 16:74661487-74661509 ATAGATAAAACATGCTATGTAGG + Intronic
1141365585 16:83439902-83439924 CTATGTAAAAAATTCTATGTAGG + Intronic
1145784791 17:27586816-27586838 CTAGGAGAAACAGACTATGTTGG - Intronic
1147199732 17:38792566-38792588 CTAGGTAACAATTCCTATGAAGG - Intronic
1153022242 18:640126-640148 CTAGGGAAGAGATCCTTTGTTGG - Intronic
1159000856 18:62973928-62973950 CTAGTTACAACATCCTTTGAAGG - Intronic
1166334677 19:42098445-42098467 CTATGATATACATCCTATGTAGG - Intronic
1167819875 19:51917859-51917881 TTAGTTAAAATATCCTATTTCGG + Intronic
929131908 2:38583913-38583935 GTATATAAAACATCCTATGAAGG + Exonic
931432083 2:62216264-62216286 CTAAGGAAAACAGCCTGTGTGGG + Intronic
933430704 2:82174135-82174157 CTAGGTATAAAATTCTAAGTTGG + Intergenic
936169812 2:110160015-110160037 CTAGGTAAAAAATACTCTCTTGG + Intronic
940466030 2:154027979-154028001 CTAAGTAAAACATACAATTTTGG + Intronic
943824665 2:192373711-192373733 CCACATAAAACATCCTATGGGGG + Intergenic
945039144 2:205729682-205729704 CTATTTAAAACATCATTTGTAGG + Intronic
946483800 2:220081461-220081483 CCAGGTAAAACATCCTCCGGTGG - Intergenic
946519668 2:220451099-220451121 CTAGGGAACTCAGCCTATGTTGG + Intergenic
947626087 2:231619819-231619841 TTAGGTAAAAAGTCCTCTGTGGG + Intergenic
1170718734 20:18856238-18856260 CTGGGTAAAACAGACTATGCTGG - Intergenic
1172529727 20:35621577-35621599 CTCAGTAAGACAACCTATGTAGG - Intergenic
1184312175 22:43653437-43653459 CTGGGAAAAACATTCTAGGTTGG - Intronic
951908680 3:27728254-27728276 GTAGGAAAGACTTCCTATGTAGG - Intergenic
963756657 3:149241450-149241472 CAAGGTATAACATTCCATGTTGG - Intergenic
964033700 3:152169698-152169720 ATAGGTAAAATTTCCTGTGTTGG + Intergenic
965884699 3:173430632-173430654 CTAGGTCACACCTCCTATATTGG - Intronic
966580232 3:181553172-181553194 TTAGGTAAAAAATCATCTGTTGG - Intergenic
967686146 3:192418975-192418997 TTAGGTAAAATAACCTGTGTAGG - Intronic
972290980 4:37689652-37689674 CTAGGTTAAACATGCAATGAAGG - Intergenic
974362350 4:60898437-60898459 CTGGGTAAAATATCCGATATTGG - Intergenic
975875919 4:78836754-78836776 CTAGCTAAAACATTATAGGTTGG + Intronic
975966621 4:79980805-79980827 CTAGGTAAAAATCCCTATGCTGG + Intronic
980541697 4:134203569-134203591 CTATCTAAAATTTCCTATGTGGG + Intergenic
982627583 4:157786655-157786677 CTAGACAAAACATTCTATGCTGG + Intergenic
987463424 5:18243355-18243377 CTAGTTCAAAGCTCCTATGTGGG + Intergenic
987840757 5:23219891-23219913 CTAGCTAAAACATACTACCTTGG + Intergenic
988416640 5:30954148-30954170 CCAGTTAAAACATCTTATTTTGG + Intergenic
993267837 5:85750606-85750628 CTTGGACAAACATCCTTTGTAGG - Intergenic
993373434 5:87119847-87119869 CTGGGAAAGACATCCTAGGTGGG + Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
993533206 5:89048895-89048917 ATAGGAAAAAGATCCTATGGTGG - Intergenic
993943022 5:94084340-94084362 ATAGGTATAACATCTTTTGTTGG - Intronic
998884212 5:146677086-146677108 CTAAGAAAAGCATCCTATGAGGG - Intronic
1008120458 6:47609887-47609909 CTAGGAAAAATATCGTATTTTGG + Intronic
1009926460 6:70126646-70126668 CAAGTTAAAACATAATATGTGGG - Intronic
1010081210 6:71865942-71865964 CTAGATATAGAATCCTATGTTGG + Intergenic
1011620832 6:89240953-89240975 CCAGGTATAGCATCATATGTAGG - Intergenic
1015570084 6:134611892-134611914 CTAGGTAATACATACTGTGATGG + Intergenic
1025774200 7:64544956-64544978 CTAAGTAAAAGAGCCTGTGTTGG + Intronic
1030890036 7:114988409-114988431 TTAGGTCAAACATAATATGTAGG + Intronic
1040657891 8:49533192-49533214 ATAGGTAAAGCATCACATGTAGG + Intergenic
1042125331 8:65532723-65532745 CTTGGTAAAAAGTCCCATGTGGG - Intergenic
1042569932 8:70152733-70152755 CTCGGTAAAAAATGCTATTTTGG + Intronic
1044136484 8:88592253-88592275 CCAGGTAAAACAACCTGTGCAGG - Intergenic
1046304918 8:112353581-112353603 CTAGATAAAAAATTCTATCTTGG - Intronic
1046735321 8:117770004-117770026 CAGGGTAAAGCATTCTATGTTGG + Intergenic
1049922700 9:380006-380028 CAAAATAAAACATCCTATGCTGG + Intronic
1050029578 9:1371496-1371518 CCAGGTATAAAATTCTATGTTGG - Intergenic
1053184748 9:36006040-36006062 CCAGGGAAGACATTCTATGTTGG + Intergenic
1186589282 X:10912782-10912804 CTGGGTATAAAATCCTGTGTTGG + Intergenic
1186689360 X:11958930-11958952 CTACCAAACACATCCTATGTTGG - Intergenic
1189242367 X:39535256-39535278 CTTGATAACACATCCTTTGTTGG + Intergenic
1194222969 X:91219065-91219087 CTAGGAGAAACACCTTATGTAGG - Intergenic
1199730412 X:150626606-150626628 CAAAATAAAACATCCTATGTTGG - Intronic