ID: 1114643092

View in Genome Browser
Species Human (GRCh38)
Location 14:24237703-24237725
Sequence TATCATCTGGGGCAGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114643088_1114643092 -10 Left 1114643088 14:24237690-24237712 CCGAAGTCTATGGTATCATCTGG 0: 1
1: 0
2: 0
3: 13
4: 184
Right 1114643092 14:24237703-24237725 TATCATCTGGGGCAGCCAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114643092 Original CRISPR TATCATCTGGGGCAGCCAGC AGG Intronic
900629676 1:3627611-3627633 TCTCATCTGCGCCAGCCATCGGG - Exonic
900641177 1:3688763-3688785 TAGCATCTGGGCCAGGCTGCGGG - Intronic
900706460 1:4083309-4083331 TTTCATCTGCTGCATCCAGCGGG + Intergenic
901066161 1:6495648-6495670 TAGCATCTGGCGCAGGCACCAGG - Intronic
904306542 1:29593822-29593844 CATCACCTGGGGCAGACAGTGGG - Intergenic
906649666 1:47503679-47503701 GAGCCTGTGGGGCAGCCAGCAGG + Intergenic
907111849 1:51933939-51933961 CAGCATCTGTGACAGCCAGCAGG - Intronic
913697497 1:121341687-121341709 TGTGGTCTGGGGCAGCGAGCAGG + Intronic
914140062 1:144938365-144938387 TGTGGTCTGGGGCAGCGAGCAGG - Intronic
914336115 1:146716349-146716371 TATTATGTGGGGCAGCGAGCCGG + Intergenic
917114063 1:171584125-171584147 CATCAACTGGGGCAGGCATCAGG + Exonic
920484886 1:206360336-206360358 TGTGGTCTGGGGCAGCGAGCAGG + Intronic
922984255 1:229853758-229853780 TCTCCTCAGGGGCTGCCAGCAGG + Intergenic
1066041994 10:31557542-31557564 GTTCAGGTGGGGCAGCCAGCTGG - Intergenic
1067259595 10:44677064-44677086 TCTCTCCTGGGGCAGCCAGTTGG + Intergenic
1069735353 10:70650358-70650380 TTTGATCTGGAGCACCCAGCTGG - Intergenic
1071208774 10:83313957-83313979 TACCATCTGTGGCAGCCCTCTGG - Intergenic
1072985940 10:100140218-100140240 TATCAGCCAGGGTAGCCAGCTGG - Intergenic
1078116274 11:8455061-8455083 CATCATGAGGAGCAGCCAGCTGG - Intronic
1079541692 11:21583937-21583959 CATCGTCAGGGGCAGTCAGCAGG + Intergenic
1083437066 11:62649797-62649819 TTTCATCCAGGGCAGCCAGGTGG + Exonic
1089137295 11:116259914-116259936 TGTCCTCTGGGGCATCCAGAAGG - Intergenic
1090432740 11:126660086-126660108 TAGGATCTGGGGCAGACAGTGGG + Intronic
1094643669 12:32300516-32300538 CATAATCTGGGGCAGTCAGAGGG + Intronic
1100261793 12:92939310-92939332 TATCATGTAGGGAGGCCAGCTGG - Intergenic
1100798589 12:98208289-98208311 TATCAGCTGGAGCAGACAGTGGG + Intergenic
1103346945 12:120257520-120257542 AAACATTTCGGGCAGCCAGCAGG - Intronic
1103656549 12:122475600-122475622 TAGCGGCTGTGGCAGCCAGCAGG - Intronic
1109275504 13:60299323-60299345 TATCATCAGGGAAAGCCAGGTGG - Intergenic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1114398954 14:22391918-22391940 CCTCATCTGGGGGAGCCACCCGG + Intergenic
1114643092 14:24237703-24237725 TATCATCTGGGGCAGCCAGCAGG + Intronic
1118008874 14:61590083-61590105 TATCAACTTGGGCAGCCAACTGG + Intronic
1124267296 15:28248183-28248205 TGTCACATGGGGGAGCCAGCTGG - Intronic
1124614721 15:31233296-31233318 TTTCCTCTGGGGCAGGCGGCAGG + Intergenic
1130276227 15:82477623-82477645 TAACAACTGGGGCAGGCAGATGG + Intergenic
1130468586 15:84205016-84205038 TAACAACTGGGGCAGGCAGATGG + Intergenic
1130495689 15:84468563-84468585 TAACAACTGGGGCAGGCAGATGG - Intergenic
1130590879 15:85209615-85209637 TAACAACTGGGGCAGGCAGATGG + Intergenic
1132109246 15:99090207-99090229 TTTCATCTGGGGGAACCACCAGG + Intergenic
1132121490 15:99179774-99179796 GTTCTTCTGGGGCAGCTAGCTGG - Intronic
1132676801 16:1124399-1124421 TACCAGCTGGGGCGGCCAGCAGG - Intergenic
1134225691 16:12388178-12388200 TTTCTTCTGGGGGAGACAGCAGG + Intronic
1134857849 16:17535638-17535660 AATCCTCTGGGGCATTCAGCTGG + Intergenic
1139352544 16:66346414-66346436 TTTCACCTGGGGCGGCCAGGAGG - Intergenic
1139997506 16:70994870-70994892 TATTATGTGGGGCAGCGAGCCGG - Intronic
1142253677 16:89003707-89003729 CACCATCAGGGGCACCCAGCTGG + Intergenic
1142869324 17:2809935-2809957 GCTCCTCTGGGGCAGCTAGCAGG + Intronic
1143319344 17:6057931-6057953 TAGCACCTGGGTCAGCCAGGAGG - Intronic
1143335816 17:6170806-6170828 CATCACATGGGGCAGCCGGCTGG - Intergenic
1145995458 17:29102434-29102456 TTTAAGCTGGGGCTGCCAGCTGG - Intronic
1146643109 17:34555907-34555929 TATCATCTGGAGGAAACAGCTGG - Intergenic
1147573645 17:41586643-41586665 TCTCCTCTGGGGGAGCCTGCGGG - Exonic
1147577764 17:41612500-41612522 TCTCCTCTGGGGGAGCCTGCGGG - Exonic
1148236808 17:45974510-45974532 GGTCAGCTGGGGCACCCAGCAGG - Intronic
1152380575 17:79940559-79940581 AATCCTCCAGGGCAGCCAGCAGG + Exonic
1157828076 18:50830720-50830742 TATGATGTGGGGCAGCCATGTGG - Intergenic
1160093237 18:75846506-75846528 TGTCTGCTGGGGCAGCCAGTGGG - Intergenic
1161512179 19:4677923-4677945 AAACATCTGGGCCAGGCAGCTGG - Intronic
1163400364 19:17088483-17088505 GAGCAGCTGGGGGAGCCAGCAGG - Intronic
1164607721 19:29612110-29612132 AATCATCTGTGGCTGCCTGCAGG - Exonic
925306317 2:2849991-2850013 CAGCAGCTGGGGCAGGCAGCAGG + Intergenic
926789914 2:16559897-16559919 TATAATCTTGGACAGCCAGAGGG - Intronic
932733283 2:74235573-74235595 TCTGAACTGGGGCACCCAGCAGG + Intronic
937877602 2:126837184-126837206 TGTCAGCAGGGACAGCCAGCCGG + Intergenic
938691171 2:133790840-133790862 TATCAGGCAGGGCAGCCAGCAGG - Intergenic
940361429 2:152800207-152800229 AATCAACTGGGGCAGGCAGCAGG + Intergenic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
946977043 2:225164623-225164645 TATCATCTCTTGCAGCCTGCAGG + Intergenic
1173021279 20:39269722-39269744 CTTCATCCGGGGCAGGCAGCAGG - Intergenic
1173330684 20:42073943-42073965 TATCCTCTCTGGCAGACAGCAGG + Exonic
1174262489 20:49306754-49306776 TACCTTCTGGGGCAGGCAGAGGG + Intergenic
1178404394 21:32312423-32312445 TCACATCTGGGGGAGCCGGCGGG - Exonic
1178523714 21:33306908-33306930 TAGCATCTGTGGGAGCCAGGAGG + Intergenic
1178654074 21:34447683-34447705 TATCTGCTGGGGCAGCCCTCCGG + Intergenic
1180880769 22:19202151-19202173 CATGATCTGGGGCCACCAGCTGG - Intronic
1182772482 22:32805245-32805267 CATCCTCTGGGGCTGGCAGCCGG - Intronic
949313384 3:2725178-2725200 TATCAGCTCTGGCAGCCACCTGG + Intronic
950906701 3:16545341-16545363 TTTCATTTGGGTCAGCCAGAAGG - Intergenic
951680997 3:25294595-25294617 TAAGATCTGGGGCAGACAGTGGG + Intronic
952168925 3:30783740-30783762 TTTCATCTGTGGGAGCCAGCTGG - Intronic
953674079 3:44986354-44986376 CATACTCTGGAGCAGCCAGCTGG - Intronic
953697311 3:45170162-45170184 TATCAGCTAGGGCAGCCAGAAGG + Intergenic
954997417 3:54894359-54894381 TGGCACCTAGGGCAGCCAGCAGG - Intronic
961486443 3:127220599-127220621 TTTTATTTGGGACAGCCAGCAGG - Intergenic
961973880 3:131001500-131001522 TTTCATTTGGGACTGCCAGCAGG - Intronic
963854339 3:150238459-150238481 TTCCATCTGGAGTAGCCAGCGGG - Intergenic
964702659 3:159586233-159586255 TATCTTTTGGGGAAGGCAGCAGG - Intronic
967206712 3:187129926-187129948 TATCATCTAGGTCACCCAGTAGG + Intronic
967980027 3:195060161-195060183 TCTCACCTGGGGCACGCAGCAGG + Intergenic
968331889 3:197877672-197877694 GATCATCTGTGTCAGCCAGCAGG + Intronic
971727410 4:30331460-30331482 CATCATGTGGGGCAGCCATCCGG + Intergenic
971859377 4:32085473-32085495 TGTCATGTGGGGCAGCCAACTGG + Intergenic
978061557 4:104345569-104345591 TATCATGTGAGGCAGCCACTTGG - Intergenic
978609038 4:110516557-110516579 TACTTTCTGTGGCAGCCAGCAGG - Intronic
982163782 4:152596024-152596046 TATCATGTGAGGCAGCCATAAGG + Intergenic
985916301 5:2921406-2921428 TGTCGTGTGGGGCAGCCACCCGG - Intergenic
995204657 5:109465872-109465894 TATAATCTTGGGCCACCAGCTGG - Intergenic
995848649 5:116521376-116521398 GAACAGCTGGGCCAGCCAGCTGG + Intronic
998436175 5:142110297-142110319 TATGACCTTGGGCAGCCTGCGGG + Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1000210860 5:159104982-159105004 TATTATCTGGGGCCGCCCGGGGG - Intergenic
1002332134 5:178450443-178450465 TAGGAGCTGGAGCAGCCAGCGGG + Intronic
1003164312 6:3663097-3663119 TGTCATCTGGGGGAGCCATCTGG + Intergenic
1007228329 6:40330214-40330236 CAAGATCTGGGGCAGCCAGTGGG + Intergenic
1008631036 6:53363374-53363396 GATCCACTGGGGAAGCCAGCTGG - Intergenic
1010081761 6:71871874-71871896 GAACTTCTGGGGCAGACAGCGGG - Intergenic
1010583251 6:77625865-77625887 TGTCATCTAGGGCAGCCAGCTGG - Intergenic
1012316857 6:97791440-97791462 TGTCATGTGGGACAGCCACCCGG + Intergenic
1012358419 6:98345809-98345831 TATCATCTCTGGCAGGAAGCAGG - Intergenic
1017722779 6:157255570-157255592 TTTCATGTGGGGCAGCCACGGGG - Intergenic
1022340195 7:29460407-29460429 TATTATCTGGCTTAGCCAGCAGG + Intronic
1026688441 7:72532547-72532569 TGACAGCTGGGGCAGCGAGCTGG + Intergenic
1026723676 7:72854430-72854452 TGACAGCTGGGGCAGCGAGCTGG + Intergenic
1030673983 7:112365780-112365802 CATCAGATGGGCCAGCCAGCTGG - Intergenic
1032794109 7:135263782-135263804 TGTCATGTGGGGCAGCCATCCGG + Intergenic
1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG + Intergenic
1046787954 8:118287907-118287929 TATCCTTAGGGGCAGCCATCAGG - Intronic
1048161706 8:132027474-132027496 TTTCGTCTGGGGCAGCCCACTGG - Intronic
1049005376 8:139852145-139852167 CATCATCTGTGGAAGGCAGCAGG - Intronic
1051103578 9:13550950-13550972 TAGCAGATGGGGCAGCCAGAAGG + Intergenic
1054871277 9:70049165-70049187 TAGCATCTGAGGCAGGCAGGTGG + Intronic
1054877341 9:70110670-70110692 AATCATGTGGGTCAGCCAGCAGG + Intronic
1057861133 9:98641795-98641817 TAGCATCTCTGGCATCCAGCAGG + Intronic
1058703550 9:107620471-107620493 CACCATCTGTGGCAGGCAGCTGG + Intergenic
1060824277 9:126679008-126679030 TATCAGCTGGGTCAGCCACTTGG + Intronic
1191787546 X:64933649-64933671 CATCATCTGGGAAAGCCAGTTGG - Intronic
1192800022 X:74456962-74456984 TATCAGCTGGGAGGGCCAGCTGG - Intronic
1193702466 X:84779906-84779928 TCTCTTCTGGGGGAGCCAGAAGG + Intergenic
1194506818 X:94743714-94743736 CATCAGCTGGGGCAGCCAAAAGG - Intergenic
1197250748 X:124214211-124214233 TTTTAGCTGGGGCAGTCAGCTGG + Intronic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic
1202273060 Y:23088897-23088919 TTTCATTTGGGTCAGCCAGGAGG - Intergenic
1202292966 Y:23331785-23331807 TTTCATTTGGGTCAGCCAGGAGG + Intergenic
1202426057 Y:24722641-24722663 TTTCATTTGGGTCAGCCAGGAGG - Intergenic
1202444732 Y:24947445-24947467 TTTCATTTGGGTCAGCCAGGAGG + Intergenic