ID: 1114645650

View in Genome Browser
Species Human (GRCh38)
Location 14:24254717-24254739
Sequence CCACGTCAAGGAGAGCGGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114645650_1114645660 21 Left 1114645650 14:24254717-24254739 CCTGCCCGCTCTCCTTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1114645660 14:24254761-24254783 GCCCCCTGGTCCACAAGATGGGG 0: 1
1: 0
2: 0
3: 15
4: 92
1114645650_1114645665 25 Left 1114645650 14:24254717-24254739 CCTGCCCGCTCTCCTTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1114645665 14:24254765-24254787 CCTGGTCCACAAGATGGGGCCGG 0: 1
1: 0
2: 2
3: 15
4: 180
1114645650_1114645655 -1 Left 1114645650 14:24254717-24254739 CCTGCCCGCTCTCCTTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1114645655 14:24254739-24254761 GCCTGAGACATTGAGCAGCATGG 0: 1
1: 0
2: 3
3: 16
4: 197
1114645650_1114645657 7 Left 1114645650 14:24254717-24254739 CCTGCCCGCTCTCCTTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1114645657 14:24254747-24254769 CATTGAGCAGCATGGCCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 144
1114645650_1114645658 19 Left 1114645650 14:24254717-24254739 CCTGCCCGCTCTCCTTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1114645658 14:24254759-24254781 TGGCCCCCTGGTCCACAAGATGG 0: 1
1: 0
2: 0
3: 14
4: 113
1114645650_1114645659 20 Left 1114645650 14:24254717-24254739 CCTGCCCGCTCTCCTTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1114645659 14:24254760-24254782 GGCCCCCTGGTCCACAAGATGGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114645650 Original CRISPR CCACGTCAAGGAGAGCGGGC AGG (reversed) Exonic
900729020 1:4239646-4239668 CCACGTCAAGGAGAGAGAAATGG - Intergenic
901528289 1:9837744-9837766 ACAAGCCAAGGAGAGCGGCCCGG + Intergenic
905210025 1:36367586-36367608 CCAGGTCCAGGAAAGCTGGCAGG + Intronic
905463215 1:38134701-38134723 CAGAGTCAAGGAGAGCTGGCTGG + Intergenic
920122725 1:203670859-203670881 CCACGGGGAGGAGAGAGGGCAGG - Intronic
923267198 1:232326358-232326380 ACAAGTCAAGGAGAGAGGCCTGG - Intergenic
923660236 1:235951120-235951142 ACACGCCAAGGAGAGAGGCCTGG + Intergenic
924112161 1:240711081-240711103 ACACGGCAGGGAGAGAGGGCGGG - Intergenic
1064074766 10:12259881-12259903 CCAAGTCACTGCGAGCGGGCAGG + Intergenic
1080743721 11:35088871-35088893 ACAAGTCAAGGAGAGAAGGCTGG + Intergenic
1083747700 11:64744831-64744853 CCGCGGCGTGGAGAGCGGGCGGG - Intronic
1084870787 11:72097447-72097469 CCAAGTCAGGGAGAGGGGGCAGG + Exonic
1085314267 11:75534865-75534887 ACACGTCAGGGAGTGCAGGCAGG - Intergenic
1096181707 12:49554745-49554767 ACAGGCCAAGGAGAGCTGGCAGG - Intronic
1100551121 12:95647132-95647154 CCAAGCCATGGAGAGCTGGCTGG - Intergenic
1101826393 12:108223832-108223854 CCACCTTAAGGAAAGGGGGCTGG - Intronic
1103496079 12:121363299-121363321 CCAAGCCAAGGAGAGAGGCCTGG - Intronic
1104407880 12:128533538-128533560 CCAAGCCAAGGAGAGAGGCCTGG - Intronic
1107769583 13:43775687-43775709 CCAAGTCAAGCAGAGAGAGCAGG - Intronic
1111660595 13:91205384-91205406 CCACGGCAAGGATAGCTGCCAGG - Intergenic
1113077115 13:106477919-106477941 CCAGGCCAAGGAGAGAGGCCTGG - Intergenic
1114645650 14:24254717-24254739 CCACGTCAAGGAGAGCGGGCAGG - Exonic
1115985887 14:39103232-39103254 CCACGTCAAGAGGAGGGGACGGG + Exonic
1118838795 14:69495791-69495813 CCATGTCAAAGAGGGTGGGCAGG - Intronic
1122055581 14:99096095-99096117 CCGCGTCCAGGAGAGCCAGCAGG + Intergenic
1122253558 14:100459687-100459709 ACAAGTCAAGGAGAGAGGTCTGG + Intronic
1125202347 15:37111047-37111069 ACACGCCGAGGAGGGCGGGCGGG - Intergenic
1129781397 15:78274261-78274283 CCACATCCAGCAGATCGGGCCGG + Exonic
1130230450 15:82092853-82092875 CCAGGTCAAGGAAAGGGGGCCGG + Intergenic
1138305118 16:55967167-55967189 CCTCCTCAAGGAGACCTGGCAGG + Intergenic
1140208224 16:72950615-72950637 CCACATCAAGGAGGGCGGCAAGG - Exonic
1151745200 17:76008197-76008219 CCACGCCAAGGTGAGCCGGGAGG - Exonic
1152196721 17:78922904-78922926 CAACATCAAGGAGAGAGGCCTGG + Intronic
1152552278 17:81035611-81035633 CGACGCCAAGGCGAGCGCGCGGG - Intronic
1155491137 18:26403082-26403104 CCAAGTCAAGGAGAAAGGCCTGG + Intergenic
1158274677 18:55754533-55754555 ACAAGTCAAGGAGAGAGGCCTGG + Intergenic
1160508058 18:79438208-79438230 CCACGGCAAAGAGAGCAGGAGGG - Intronic
1161089119 19:2351489-2351511 CCAGGTAGAGGAGAGCGGGCTGG - Exonic
1163294835 19:16405332-16405354 CCACGCCAAGGAGACTGCGCTGG + Intronic
1163485770 19:17584617-17584639 CCACCCCAGGGAGAGGGGGCTGG + Intergenic
1165157645 19:33797609-33797631 CCAGGTCAGGGGGTGCGGGCGGG - Intronic
1166717453 19:44977544-44977566 CCAAGTCCAGGAGGGCAGGCAGG + Intronic
1167383234 19:49150302-49150324 CCTCGCCGGGGAGAGCGGGCGGG + Exonic
1167595514 19:50425808-50425830 CCAGGTCAGGGAGCGCAGGCAGG + Intronic
1168095856 19:54114600-54114622 CCACATCCTGGAGAGCGAGCTGG - Exonic
1168267919 19:55232290-55232312 TCAGCCCAAGGAGAGCGGGCTGG + Intronic
926402750 2:12515296-12515318 ACACGTCTAGGAGAGTGGGTCGG - Intergenic
926635281 2:15171870-15171892 ACACGCCAAGGAGAGAGGCCTGG + Intronic
927736388 2:25526301-25526323 CCACCTCAGGGAGAACGGACAGG + Intronic
929061071 2:37925218-37925240 CCACGAGAGGGAGAGGGGGCGGG + Intronic
929617699 2:43325131-43325153 CAACTTCCAGGAGAGAGGGCAGG - Intronic
930587159 2:53280791-53280813 CCTCGTCAAGGAGATCAGGGAGG + Intergenic
933605115 2:84374628-84374650 ACAAGTCAAGGAGAGAGGCCTGG + Intergenic
936239848 2:110777846-110777868 CCACTTCAAGGAGTCGGGGCAGG + Intronic
937844647 2:126566173-126566195 GCACTGCAAGGAGAGAGGGCAGG + Intergenic
938151875 2:128894042-128894064 CCAAGCCAAGGAGAGAGGCCTGG + Intergenic
942046013 2:172100060-172100082 CCACGTGGGGGAGGGCGGGCAGG + Exonic
1175011544 20:55742734-55742756 CCAAGTCATGGAGAGACGGCTGG + Intergenic
1176414619 21:6467539-6467561 CCACGGCGAGGGGAGCAGGCGGG + Intergenic
1179690117 21:43075861-43075883 CCACGGCGAGGGGAGCAGGCGGG + Exonic
1180008309 21:45033409-45033431 CCACGGCCAGGAGAGAGGGAGGG - Intergenic
1184369051 22:44070993-44071015 CCAGGCCAAGGCGGGCGGGCAGG - Intronic
1185316625 22:50182134-50182156 CCACGTCCAGGAGAGGGACCCGG + Intergenic
1185374097 22:50474425-50474447 CCACCCCAAGGAGGCCGGGCAGG + Intronic
953561418 3:43995986-43996008 CCATGTAAAGGAGAAAGGGCAGG + Intergenic
960973978 3:123157898-123157920 GCACGTCAAGGTGTGCAGGCTGG + Intronic
968568573 4:1327760-1327782 CCACGACAGGGAGGGCTGGCAGG - Intronic
969540772 4:7787698-7787720 CCCCTTCAAGGAGGGCAGGCCGG + Intronic
970652242 4:18191748-18191770 CCAGGTAAAGGAGAAGGGGCAGG - Intergenic
972841346 4:42933369-42933391 CAACATCAAGGAGAGCTGCCTGG + Intronic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
973894302 4:55396387-55396409 CCGGGTCGAGGTGAGCGGGCCGG + Exonic
975839633 4:78459788-78459810 CCAAGCCAAGGAGAGAGGCCTGG - Intronic
984662489 4:182388232-182388254 CTACGTCAAGGAGACCAGGTGGG - Intronic
985643301 5:1073726-1073748 CGACGTGAAGGACAGCAGGCGGG + Exonic
986402645 5:7395635-7395657 CTACCTCAAGGTCAGCGGGCAGG - Intergenic
987491420 5:18584441-18584463 CCAAGCCAAGGAGAGAGGCCTGG - Intergenic
988660180 5:33257882-33257904 ACAAGCCAAGGAGAGAGGGCTGG + Intergenic
989368682 5:40682171-40682193 CCACGTCTAACAGAGGGGGCGGG - Intronic
991613253 5:68469764-68469786 CCAAGCCAAGGAGAGCAGCCTGG + Intergenic
993916280 5:93745741-93745763 CCAAGTCAGAGAGAGAGGGCAGG + Intronic
997379430 5:133424740-133424762 CCACGTAAAGGAGAGAGTACTGG + Intronic
997617744 5:135263514-135263536 CCACGCGGAGGAGAGCGGGTGGG - Intronic
1002434651 5:179223151-179223173 CCACCTCTAGGAGAGCGCTCTGG + Intronic
1005844669 6:29768092-29768114 CCCAGTGAAGGAGAGAGGGCAGG - Intergenic
1005874084 6:29998227-29998249 CCCAGTGAAGGAGAGAGGGCAGG - Intergenic
1006146570 6:31963167-31963189 CCACAGCAAGGAGAGCGGTCAGG + Intronic
1007451051 6:41940781-41940803 CCCCGTCAAGGGGAGAGGGGAGG - Intronic
1011750639 6:90451373-90451395 CCACGACAAGAAGAGGGGGTGGG + Intergenic
1017907543 6:158767386-158767408 CCATGTCCAGGAGAGCTTGCAGG - Exonic
1019214518 6:170434689-170434711 CCACGTCAATGAGGGAAGGCTGG + Intergenic
1019477935 7:1252914-1252936 CCACGTAGAGGAGGGCGGGGCGG + Intergenic
1022623571 7:32010734-32010756 CCAAGCCAAGGAGAGAGGCCTGG - Intronic
1024064109 7:45718694-45718716 CCAAGTCAAGCAGAGCTGGGTGG + Exonic
1024472158 7:49775407-49775429 CCACGTCCCGGCGGGCGGGCGGG - Exonic
1026106565 7:67425284-67425306 CCATGTCAAGGAAATCCGGCTGG - Intergenic
1030798223 7:113816191-113816213 ACAAGTCAAGGAGAGAGGCCTGG - Intergenic
1035432053 7:158829597-158829619 GCACGTCACCGGGAGCGGGCGGG + Exonic
1037984955 8:23284704-23284726 CCACGGCAAGGAGAGTGTGCTGG + Intronic
1039885280 8:41650715-41650737 CCAGGGCAAGGAGAGAGGCCAGG - Intergenic
1042271508 8:66961363-66961385 CCCGGTCAAGGTAAGCGGGCGGG - Exonic
1042877722 8:73455185-73455207 CCAGCCCAAGCAGAGCGGGCAGG - Intronic
1056435786 9:86575038-86575060 CCAAGTGAAGGAGAGAGGGATGG - Intergenic
1057596107 9:96417600-96417622 CCACCTCAAGGTGAGCGGCGCGG - Exonic
1058058553 9:100473256-100473278 CCGCGGCGAGGGGAGCGGGCGGG - Exonic
1058939243 9:109798078-109798100 CCAAGTCCAGGAGAGAGGCCTGG - Intronic
1060855906 9:126914966-126914988 CCGCGTCAAGGTGACCGGCCGGG + Exonic
1061874737 9:133538017-133538039 CCATGGCATGGAGAGCGTGCTGG + Intronic
1203778925 EBV:89834-89856 CCACTTCAAAGAGAGCCGACAGG + Intergenic
1189534694 X:41923803-41923825 CCGCGTCACGGCGAACGGGCGGG + Intergenic